Reagents and antibodies
Antibodies against G6PD (#12263), Ubc9 (#4786), SUMO1 (#4930), and Normal rabbit IgG (#3900) were purchased from Cell Signaling Technology. Ubiquitin (10201-2-AP), Beta Actin (66009-1-Ig), HA (51064-2 AP), Myc (60003-2-Ig), PKCδ (14188-1-AP), and Beta Tubulin (66240-1-lg) were purchased from Proteintech. Antibodies against Phospho-serine (sc-81514), Phospho-threonine (sc-5267), and SENP1 (sc-271360) were purchased from Santa Cruz Technology. Antibody against Thiophosphate ester (ab92570) was purchased from Abcam. Anti-Flag (F1804) antibody was purchased from Sigma-Aldrich. G6PD pT236-specific antibody was produced by Bioworld Technology. MG132 (S2619), Cycloheximide (S7418), U0126-EtOH (S1102), SP600125 (S1460), Ginkgolic acid (S9432), Chloroquine (S6999), and Rottlerin (S7862) were purchased from Selleck. Actinomycin D (HY-17559), Menadione bisulfite sodium (HY-B1897A), BJE6-106 (HY-117800), and Sotrastaurin (HY-10343) were purchased from MedChemExpress. H2O2 (H1009), Poly (2-hydroxyethyl methacrylate) (P3932), and N-Acetyl-L-cysteine (A9165) were purchased from Sigma-Aldrich. Disuccinimidyl Suberate (ab141274) was purchased from Abcam. Cisplatin (CSN1065), Bisindolylmaleimide I hydrochloride (CSN10464), Midostaurin (CSN15884), and VX-702 (CSN16018) were purchased from CSNpharm. Phos-tagTM AAL-107 was purchased from WAKO. [1,2-13C2]-D-glucose (IR-35105) was purchased from ISOREAG. Glucose-free DMEM (PM150271) was purchased from Procell.
Cell culture and transfection
HEK293T, HCCLM3, Huh7, PLC/PRF/5 cells were obtained from Cell Bank of Chinese Academy of Sciences, Shanghai, China. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (ExCell Bio, FSP500). Transfections of HEK293T cells were performed using the calcium phosphate method, and other cells were performed using Entranster-H-4000 transfection reagent (Engreen Biosystem Co.) according to the manufacturer’s instructions.
Plasmid construction
SUMO1 and Ubc9 plasmids with HA or Myc tag were constructed previously [30]. PCR-amplified human G6PD, PKCδ, SENP1, and TRIM21 were cloned into pcDNA3.1-Flag/HA, PGEX-4T-1, pCold I -His, or pCDH-CMV-MCS-EF1-Puro-Flag vectors. The point mutations in G6PD, PKCδ, SUMO1, and Ubc9 were generated using the QuickChange method. The shRNA target or guide RNA sequences were as follows: (5′-3′):
pLKO.1 human Control shRNA: CAACAAGATGAAGAGCACCAA
pLKO.1 human G6PD shRNA: CTCAATGCCCTGCCATTAAAT
pLKO.1 human PKCδ shRNA-#1: TCAGAGCCTGTTGGGATATAT
pLKO.1 human PKCδ shRNA-#2: GTTTGAACCACCAGGTTTATT
SENP1 sgRNA control: CTTCCGCGGCCCGTTCAA
SENP1 sgRNA #1: GCTTTCGCTTTCTGACCAGC
SENP1 sgRNA #2: GTGTAAAGGAAAATGTGTGG
Immunoprecipitation
Cells with different treatments were harvested and lysed with ice-cold lysis buffer (1% Triton, 20 mM Tris, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, and 2.5 mM Sodium pyrophosphate) supplemented with protease inhibitor cocktail. To preserve SUMOylation modifications, 20 mM N-ethylmaleimide (NEM, Sigma-Aldrich, Cat# E3876) was included in the lysis buffer to inhibit deSUMOylating enzymes. Lysates were centrifuged at 12,000 × g for 15 min at 4 °C, the supernatants were transferred into a new tube with protein A/G agarose and antibody for rotation 3 h at 4 °C, and washed three times with lysis buffer, precipitant was added loading buffer for western blot analysis.
G6PD activity assay
Cells transfected with Flag-tagged G6PD or its mutants were lysed in ice-cold lysis buffer, followed by immunoprecipitation with protein A/G beads plus anti-Flag antibodies for 3 h at 4 °C with gentle rotation. Beads were washed three times with cell lysis buffer, followed by competitive elution using 100 μg/mL 3 × Flag peptide (Sigma-Aldrich, Cat# F4799) in TBS (50 mM Tris-HCl, pH 7.4, 150 mM NaCl) for 1 h at room temperature. The purified protein was used for G6PD enzymatic activity using the G6PDH Activity Assay Kit (Beyotime, Cat# S0189) according to the manufacturer’s instructions.
Real-time quantitative PCR
Total RNA was extracted from cells using TRIzol (Invitrogen) according to the manufacturer’s instructions. Extracted RNA was used for complementary DNA synthesis by using a HiScript III SuperMix kit (R323-01, Vazyme). Quantitative real-time PCR was carried out in the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad) using ChamQ Universal SYBR qPCR Master Mix (Q711-02, Vazyme). β-Actin as the normalization gene. qRT–PCR primer sequences used in this study: G6PD, 5′-CCTACGGCAACAGATACAAGA -3′ and 5′- GCCCTCATACTGGAAACCC -3′; β-Actin, 5′- GTCACCAACTGGGACGACA -3′ and 5′- CACAGCCTGGATAGCAACG -3′.
Protein phosphorylation analysis using Phos-tag SDS-PAGE
Phosphorylated protein separation was performed using Phos-tag acrylamide. Briefly, 10 mL SDS-PAGE resolving gel buffer should add 100 μL 5 mM phospho-Tag and 100 μL 50 mM MnCl2, including the APS, TEMED, and the stacking gel (4% acrylamide) was prepared without phos-tag additives using Tris-HCl (pH 6.8). After electrophoresis, gels were equilibrated in pre-chilled transfer buffer containing 10 mM EDTA with two 15-min washes to chelate Mn²⁺ ions. Proteins were subsequently transferred to PVDF membranes.
Protein oligomerization analysis using DSS crosslinking
Chemical crosslinking was performed using disuccinimidyl suberate (DSS, Abcam, Cat# ab141274). Cells were lysed in HEPES-based buffer (30 mM HEPES, pH 7.4, 150 mM NaCl, 1% NP-40) lacking protease inhibitors to prevent interference with crosslinking chemistry. Lysates were centrifuged at 12,000 × g for 15 min at 4 °C to remove cellular debris. Supernatants were transferred into a new tube and mixed with 0.1 mM DSS for 20 min with rotation at room temperature. The reaction was quenched by adding Tris-HCl pH 7.2 to a final concentration of 50 mM for 10 min. Samples were boiled in SDS loading buffer and analyzed by Western blot.
Immunofluorescence
Cells were seeded on microscope cover glass and fixed with 4% paraformaldehyde for 15 min at room temperature. After three washes with PBS, cells were permeabilized and blocked with blocking buffer (3% bovine serum albumin, 0.2% Triton X-100 in PBS) for 30 min at room temperature. Primary antibodies were incubated with samples for 16 h at 4 °C in a humidified chamber. After five sequential washes (15 min each) with stringent washing buffer (0.2% BSA, 0.05% Triton X-100 in PBS), cells were incubated with secondary antibodies for 1 h at room temperature in the dark. Nuclei were counterstained with 1 μg/mL DAPI (Sigma-Aldrich, Cat# D9542) in PBS for 15 min. The stained cells were imaged using an LSM 800 microscope (Zeiss).
GSSG/GSH and NADP+/NADPH analysis
Intracellular GSSG/GSH levels were assayed using GSH and GSSG Assay Kit (S0053, Beyotime), and intracellular NADP+/NADPH were assayed using NADP+/NADPH Assay Kit with WST-8 (S0179, Beyotime) by microplate reader according to the manufacturer’s instructions.
Cell death analysis
Cell death was assessed using propidium iodide (PI) staining. Briefly, cells were harvested and washed with PBS and then stained with 5 μg/mL PI for 15 min in the dark. After staining, cells were washed with PBS and immediately analyzed using a Beckman Coulter CytoFLEX flow cytometer.
Intracellular ROS detection
Cellular ROS levels were assessed using CellROX® Green Reagent (Thermo Fisher, cat#C10444). Briefly, cells were seeded in 6-well plates and allowed to adhere for 24 h. The culture medium was then supplemented with CellROX® Green Reagent to a final concentration of 5 μM, followed by incubation at 37 °C for 30 min in the cell culture incubator. Then cells were harvested and analyzed by flow cytometer (Beckman Coulter), and the mean fluorescence intensity (MFI) was quantified to determine intracellular ROS levels.
DNA synthesis analysis
DNA synthesis rate was assayed using BeyoClick™ EdU Cell Proliferation Kit with Alexa Fluor 488 (C0071S, Beyotime) and detected by flow cytometer (Beckman Coulter) according to the manufacturer’s instructions, and the mean fluorescence intensity (MFI) was used to calculate.
Purification of protein in E. coli
GST, GST-PKCδ, his-G6PD, his-G6PD T236A, his-PKCδ, and his-PKCδ K378A were transformed into E. coli strain BL21, the protein expression was induced by adding 0.1 mM IPTG (Isopropyl-beta-D-thiogalactopyranoside) into LB medium under 16 °C for 22 h. E. coli were lysed and sonicated, followed by purification with glutathione sepharose (for GST tag fusion protein) or Ni-NTA agarose (for his tag fusion protein). Unbounded proteins were removed by washing the beads with lysis buffer three times, bounded proteins were eluted with 10 mM reduced glutathione (for GST-fusion proteins) or 250 mM imidazole (for 6His fusion proteins). The eluted proteins were dialyzed against PBS containing 5% (v/v) glycerol at 4 °C.
GST pull-down assay
Glutathione sepharose-bound GST or GST-fusion proteins were incubated with 1 μg His-tagged proteins in 800 μL PBS including PMSF at 4 °C and rotated for 2 h. After interaction, unbounded proteins were removed by washing the beads three times. Protein complexes were eluted by boiling in 2 × SDS loading buffer at 100 °C for 10 min, followed by centrifugation at 12,000 × g for 5 min to collect supernatants for SDS-PAGE analysis.
In vitro kinase reaction assay
Purified GST-PKCδ (200 ng) and 1 μg His-G6PD WT or T236A were mixed into 50 μL kinase buffer (25 mM MOPS, PH 7.2, 12.5 mM β-glycerol-phosphate, 25 mM MgCl2, 5 mM EGTA, 2 mM EDTA, 0.25 mM DTT) in the presence or absence of 0.2 mM ATPγS or ATP and rotated for 30 min at 30 °C. For ATP, the reaction was eliminated by adding SDS loading buffer and analyzed by western blotting. For ATPγS, the reaction mixture was alkylated for 1 h at 30 °C by adding PNBM (final concentration was 2.5 mM), and the lysates were analyzed by western blotting.
Gene modulation by lentiviral systems
Gene knockdown, knockout, or overexpression was achieved using lentiviral-based delivery systems. For gene knockdown, short hairpin RNAs (shRNAs) targeting specific genes were cloned into the lentiviral vector pLKO.1-puromycin. For gene knockout, single-guide RNAs (sgRNAs) targeting specific genes were cloned into the lentiCRISPR v2 vector. For gene overexpression, full-length coding sequences were inserted into the PCDH-puromycin vector. For lentivirus production, the respective lentiviral plasmids (pLKO.1-shRNA, lentiCRISPR v2-sgRNA, or PCDH-overexpression construct) were co-transfected into HEK293T cells with the packaging plasmids pMD2.G and psPAX2 at a ratio of 4:2:1. Viral supernatants were harvested at 48 and 72 h post-transfection, pooled, and filtered through a 0.45 μm filter (Millipore). Target HCC cells at approximately 40% confluence were incubated with the viral particles in the presence of 6 μg/mL polybrene for 24 h. Subsequently, transduced cells were selected with 1.5 μg/mL puromycin for 72 h. Knockdown, knockout, or overexpression efficiency was validated by immunoblotting using antibodies against the respective target proteins.
Metabolic flux analysis
Cells were cultured in 10 cm dishes until they reached the desired confluence. The culture medium was then aspirated, and the adherent cells were rinsed three times with phosphate-buffered saline (PBS). To initiate metabolic labeling, the medium was replaced with DMEM (glucose-free) supplemented with 2% dialyzed serum and containing 5 mM [1,2-13C2]-D-glucose, and the cells were incubated for 10 h under standard culture conditions. Following the incubation period, the labeling medium was carefully removed. The cells were rapidly washed three times with 4 mL of ice-cold ammonium bicarbonate solution (100 mM, pH 7.8; prepared as 1.178 g/100 mL in ultrapure water) that had been pre-chilled on ice for at least 30 min. A final 1 mL aliquot of the ice-cold ammonium bicarbonate solution was added to the dish, and the cells were gently detached using a cell scraper. The resulting cell suspension was immediately transferred to a pre-chilled centrifuge tube and pelleted by centrifugation at 2000 × g for 5 min at 4 °C. The supernatant was carefully aspirated and discarded. The cell pellet was then flash-frozen in liquid nitrogen for 15 s and stored at −80 °C until further processing. Sample preparation and subsequent mass spectrometry-based metabolic flux analysis were conducted by Shanghai Applied Protein Technology Co., Ltd.
Animal model
All animal experiments received ethical approval and were performed in accordance with the guidelines of the animal center of Nanchang University (Approval Number: NCULAE-20241010003). For in vivo xenograft studies, a total of 5 × 106 HCCLM3 cells in 100 μL PBS were transplanted subcutaneously into the flank of the male Balb/c nude mice (4–6 weeks old). In case of cisplatin treatment, the tumor-bearing mice were randomized according to tumor volume. Cisplatin (5 mg /kg body weight, 50 µL per mouse) or vehicle (0.9% NaCl) alone was delivered on days 10, 13, 16, 19, 22, and 25 after transplantation. After 28 days of transplantation, mice were sacrificed, and the tumors were weighed and photographed. The tumor tissue was fixed in 4% formaldehyde for immunobiological staining. For orthotopic liver implantation studies, HCCLM3 cells stably expressing shRNA-resistant wild-type (rWT) or SUMOylation-deficient (rK238R) G6PD were harvested and resuspended in PBS. A total of 1 × 10⁶ cells in 30 μL of the PBS/Matrigel suspension were slowly injected into the liver parenchyma of the Male Balb/c nude mice (4–6 weeks old). After 28 days, mice were sacrificed, and livers were excised for tumor volume (V = 1/2 a2b (V, volume; a, shortest diameter; b, longest diameter)) measurement and photographic documentation. In our trial, the tumor diameter did not exceed the ethics committee’s maximum permitted size of 20 mm.
Tissue microarrays immunohistochemical staining and scoring
The tissue microarray used was a commercial HCC tissue microarray (HLivH180Su11, Shanghai Outdo Biotech Co., Ltd.) (acceptance no.: SHYJS-CP-1701002), containing 83 paired HCC tumor tissues and adjacent non-tumor tissues. The EnVision+ detection system (Dako) was used according to the manufacturer’s instructions. Immunostained microarrays were scored by multiplying proportion score (0–4) and staining intensity score (0–3) as described previously [30].
Quantification and statistical analysis
All quantitative data are presented as the mean ± SEM or SD of at least 3 independent experiments. The difference between two groups was performed using the two-tailed Student’s t-test, and multiple group comparisons were conducted using one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test. Overall clinical patient survival was analyzed with Kaplan–Meier survival analysis. The significance thresholds were defined: *p < 0.05 was significant; NS not significant.
