Cell culture media
DMEM (no. 11965092), RPMI 1640 (no. 21870084), MEM nonessential amino acids (NEAA; no. 11140-035), 50 mM β-mercaptoethanol (no. 31350-010), GlutaMAX (no. 35050-061), L-glutamine (no. 25030081) and recombinant leukemia inhibitory factor (LIF; no. A35935) were purchased from Thermo Fisher Scientific. In addition, 2% gelatin (no. G1393-100ml), gentamycin (no. G1272-10ml) and FBS (no. F7524, 500 ml) were purchased from Merck Life Science UK (Sigma-Aldrich). Puromycin (no. ant-pr-1) was from Invitrogen, and G418-disulphate (no. G4185) was from Formedium.
Radiopharmaceuticals
Saline solution of [99mTc]TcO4− (Tc-99m-pertechnetate, sodium salt) was purchased from the West of Scotland Radionuclide Dispensary, NHS Greater Glasgow and Clyde, and, depending on experimental purpose, was added to cell culture media or phosphate-buffered physiological saline (PBS) for in vivo use, respectively. [18F]BF4− (F18-tetrafluoroborate, sodium salt; TFB) was produced in-house at the West of Scotland Glasgow PET Centre and constituted in PBS for in vivo use as previously described35.
BLI and substrate
In vivo BLI was performed on an In Vivo Imaging System (IVIS) Spectrum instrument (Revvity) with the following acquisition settings: open emission filter, blocked excitation filter, medium binning, f stop 1, FOV of 6.6 × 6.6 cm, 13.3 × 13.3 cm or 22.8 × 22.8 cm, respectively, and acquisition times between 0.5 seconds and 60 seconds. D-luciferin (XenoLight D-Luciferin K+ salt, no. 122799, Revvity) was used as a 15 mg ml−1 filter-sterilized (0.22 μm) solution in 1× PBS (pH 7.0). Images were acquired and analyzed with Living Image 4.5.4 software (Revvity).
Generation and characterization of R26
LSL-NRL mES cells and subsequent mouse lines
HM1 mES cells36 were grown on an irradiated drug-resistant 4 mouse embryonic fibroblast (DR4 MEF)37 monolayer in ES cell medium (DMEM, 15% FBS, 1× GlutaMAX, 1× NEAA, 0.1 mM β-mercaptoethanol, 1,000 U ml−1 LIF and 33 µg ml−1 gentamycin). Then, 8 × 106 HM1 mES cells were electroporated with 40 μg of a SwaI-linearized Rosa26 targeting vector containing an expression cassette comprising the CAGSA promoter (cytomegalovirus enhancer, chicken β-actin promoter, rabbit β-globin splice acceptor and an additional splice acceptor site), an LSL neomycin resistance gene (NeoR) cassette and a compound cDNA encoding an mNIS−RFP fusion, P2A and Luc2. Cells were plated onto DR4 MEF monolayers under ES cell medium supplemented with 200 μg ml−1 G418 for selection. Surviving colonies were picked onto 96-well plates and screened for correct targeting by polymerase chain reaction (PCR) across both the 5′ and 3′ homology arms using internal primers from within the novel inserted sequence and external primers from genomic sequences outside the extent of the homology arms (CGCCTAAAGAAGAGGCTGTG and AGTGCAGTGGCACAGTCTTG for the 5′; ACGACCGCAGTTCCTATGAC and CACTGACCATCATGCCTCTG for the 3′).
After identification of correctly targeted clones, mouse lines were generated by injection of ES cells into C57BL/6J mouse blastocysts according to standard protocols38. After breeding the chimeras, germline offspring were identified by coat color, and the presence of the modified allele was confirmed with primers specific for the optimized Rosa26-mNIS transgene (ATCCCCATCAAGCTGATCC and TACCACCCACGGTCGTGTAC; 659 base pairs). The R26LSL‑NRL inducible triple‑reporter mouse (cat. no. 162485) is available from CancerTools.org.
Locus targeting analysis
For locus targeting analysis, two R26LSL-NRL/wt mice were euthanized, and their spleen genomic DNA was extracted, processed according to the targeted locus amplification (TLA) protocol39, sequenced and mapped at Cergentis B.V.
Functional in vitro analysis of mNIS and Luc2 activity
For functional in vitro analysis of mNIS and Luc2 activity and inducibility, the parent R26-LSL-mNIS-RFP-Luc2 cells were transfected by electroporation with pCAGGS-Cre-internal ribosome entry site (ires)-PURO plasmid (courtesy of F. Stewart, University of Dresden). Cells were selected under puromycin (1 μg ml−1) for 2 days, and surviving cells were re-plated (4.5 × 104 or 9.0 × 104 cells per plate) onto 10-cm dishes of irradiated MEFs. Individual clones were tested for Cre recombination by PCR from sequences 5′ of the upstream loxP into the tripartite cDNA. Oligos used were as follows: SAFor primer (GCTGTCTCATCATTTTGGCAAAG; murine NIS TagRFP internal reverse primer: TACCACCCACGGTCGTGTAC). Prior to functional assay experiments, the parent ES cells and a selection of clonal lines stably expressing the murine NIS-TagRFP-Luc2 tripartite cDNA (henceforth called ‘PARENT’ and CRE1−CRE4, respectively) were weaned off the MEF feeder layer over three subsequent passages with progressively lower MEF monolayer density on plates coated with a solution of porcine gelatin in PBS (0.1% w/v).
In vitro bioluminescence assay experiments
Gelatin was used to coat 24-well, black, clear-bottom plates (VisiPlate-24 Black; Revvity). R26-mNIS-RFP-Luc2 cells described above were seeded in ES cell growth medium at 2.5 × 104 cells per well and incubated in 5% CO2 at 37 °C for approximately 48 hours. For assay experiments, the medium was removed, and 1 ml of fresh growth medium at 37 °C and containing 150 µg ml−1 D-luciferin was added to each well. Plates were then transferred immediately to the IVIS Spectrum instrument, and a single image using default settings was acquired 5 minutes after adding the D-luciferin-containing medium. Cells were then harvested by trypsinization, and cell counting was performed using a CellDrop Automated Cell Counter (DeNovix). Total flux (p s−1) measured for a region of interest (ROI) covering the whole of the well and normalized to cell number (p s−1 per cell) was reported. Four wells were used as replicates; the experiment was conducted once.
In vitro radioactivity uptake experiments
R26-mNIS-RFP-Luc2 cells described above were seeded at 1 × 105 cells per well in 12-well, gelatin-coated plates in ES cell medium and incubated in 5% CO2 at 37 °C for approximately 48 hours. For assay experiments, the medium was removed, and 1-ml samples of medium containing, at application time, approximately 50 kBq ml−1 99mTcO4− were added per well to plates containing the tested cells. At the end of incubations, 60 minutes from the addition of radioactivity, the medium was removed rapidly, and the plates were washed immediately with 5 ml of ice-cold PBS per well. Cells were lysed by the addition of 1 ml of RIPA Lysis and Extraction Buffer (Thermo Fisher Scientific/Life Technologies) per well, 10-minute incubation on ice and 15 minutes of gentle rocking at 4 °C. Radioactivity of the lysates was measured using an Automatic Gamma Counter (Hidex). Events within the energy window of 15−200 keV were used in analysis, as described previously32. The respective cellular protein concentrations, measured using Pierce BCA Protein Assay Kit (Thermo Fisher Scientific), were used for uptake normalization. Four wells were used as replicates; the experiment was conducted once.
Animal husbandry
All animal experiments were performed in accordance with UK Home Office project licenses (PPLs) PP4144283 (Lewis), PP0604995 (Bird), PP8993874 (Strathdee) and 70/8645 (Blyth) and in accordance with the UK Animal (Scientific Procedures) Act 1986 and European Union Directive 2010. They were subject to review by the animal welfare and ethical review board of the University of Glasgow. Humane endpoints were determined by clinical signs (including weight loss and abdominal distension), and we confirm that no animal exceeded maximal tumor burden or severity limits prior to immediate euthanasia. Mice were housed under controlled conditions (individually ventilated cages in a dedicated barrier facility, 12-hour light/dark cycle, 19–22 °C, 45–65% humidity) with access to food and water ad libitum and environmental enrichment. No randomization or blinding was performed, and no mice were excluded unless otherwise indicated.
Alleles used in this study were as follows: Gt(ROSA)26Sortm23(CAG-LSL-mNIS-RFP-P2A-Luc2-INV)Bea (R26LSL-NRL), Ctnnb1tm1Mmt (Ctnnb1lox(ex3))40, Gt(ROSA)26SorDM-lsl-Myc (R26LSL-MYC)29, Krastm4Tyj (KrasLSL-G12D)41, Trp53tm1Brn (Trp53fl)42, Tg(CMV-cre)1Cgn (CMV-cre)21 and Gt(ROSA)26Sortm2(cre/ERT2)Brn (R26cre-ERT2)22 (Extended Data Table 1). Mice of both sexes on a mixed (129/C57BL/6J) background were used unless otherwise specified. Ear-notch samples collected at 3−4 weeks of age for identification were used for genotyping by Transnetyx.
Tumor induction
Liver tumors were induced in 8−24-week-old male and female NRL-BM or BM littermate control mice using AAV8.TBG.PI.Cre.rBG (AAV8-TBG-Cre; Addgene, 107787-AAV8) viral vector (AAV8 with payload under thyroxine-binding globulin promoter with hepatocyte tropism)26. Control NRL-BM animals were infected with AAV8.TBG.PI.Null.bGH virus (AAV8-TBG-Null; Addgene, 105536-AAV8) serving as a genetic control. Virus (6.4 × 108 or 2.5 × 109 genomic copies per mouse as indicated) was diluted in 100 μl of PBS and injected via the tail vein43. Post-induction BLI started from day 17 and continued approximately every 2−4 weeks until endpoint. PET/MRI was performed near endpoint.
Lung tumors were induced in 12−19-week-old male and female NRL-KP or KP littermate control mice by bilateral intranasal inhalation of 5 × 107 PFU of Ad5CMVCre (University of Iowa Viral Vector Core) as CaCl2 (9.5 mM) precipitate in Modified Eagle’s Medium (Sigma-Aldrich, M-0268) and administered in a total volume of 70 µl per mouse44. Post-induction BLI started from day 30 and continued approximately every month until endpoint. PET/MRI was performed near endpoint.
Tamoxifen induction in R26
LSL-NRL/cre-ERT2 mice
Tamoxifen powder (Sigma-Aldrich, T5648) was dissolved with sonication in warm (37 °C) ethanol at 20 mg ml−1. This was then dissolved at 1:9 in sunflower oil (Sigma-Aldrich, S5007) to a final concentration of 2 mg ml−1 tamoxifen. Unless stated otherwise, a total of four doses, each containing 20 mg of tamoxifen per kg of body weight, were administered intraperitoneally at 48-hour intervals to induce activation and nuclear translocation of cytoplasmic Cre-ERT2. Further experiments were carried out 7−21 days from the administration of the last dose of tamoxifen.
In vivo BLI
Adult male and female mice were injected intraperitoneally with 150 mg kg−1 D-luciferin solution, anesthetized with 2% isoflurane in 95% O2/5% N2 and transferred to the IVIS instrument, and a single image was acquired 20 minutes from D-luciferin injection using default settings of stage height D and exposure times between 0.5 seconds and 60 seconds, using Living Image software.
Ex vivo bioluminescence imaging for R26-LSLmNIS-RFP-Luc2 induction
For measurements of organ bioluminescence, adult male and female mice were imaged as described for BLI and then culled by cervical dislocation immediately after imaging. Tissue samples were then rapidly collected and placed, one sample per well, in black, clear-bottom tissue culture plates (six-well plates, Corning Falcon, or 24-well plates, Revvity) using passive measures preventing temperature loss by the tissues (insulated dissection tables and transport boxes). The plates were then transferred into the IVIS instrument, where the tissue samples were equilibrated thermally for 2−3 minutes. A single image was then acquired 40 minutes from D-luciferin injection using default settings with an FOV on stage height D and exposure times between 0.5 seconds and 60 seconds. Total flux (p s−1) was measured with an ROI covering the whole of the well and normalized to tissue weight and reported (p s−1 mg−1).
In vivo radioactivity biodistribution
Adult male and female mice were anesthetized and intravenously injected with radiopharmaceutical ([99mTc]pertechnetate or [18F]TFB; see below), as described for [18F]TFB PET/MRI experiments. After 90 minutes, anesthetized animals were euthanized, and tissue samples were collected and weighed. Radioactivity from tissue samples was then measured using an Automatic Gamma Counter (Hidex). Events within the energy window of 15−200 keV ([99mTc]pertechnetate) or 400−800 keV ([18F]TFB) were used in analysis. Injected dose was calculated as the product of the expelled syringe volume and volumetric activity obtained from standard volume−activity curve of the injected stock, measured as described above and decay corrected to the same reference time. Standard uptake values were calculated as follows:
$$\mathrm{SUV}=\frac{{c}_{\mathrm{tissue}}/{W}_{\mathrm{tissue}}}{ID/BW}$$
where ctissue is tissue activity (Bq); Wtissue is tissue wet weight (g); ID is the injected dose (Bq); and BW is the body weight of the animal (g).
PET/MRI and data analysis
Adult male and female mice, anesthetized with 1.0–2.5% isoflurane in 95% concentrated oxygen in 5% nitrogen, were injected intravenously with 0.35−0.45 MBq of [18F]TFB per g of body weight in 200−250 µl of saline (0.9% NaCl) via a tail vein cannula and then transferred to a NanoScan PET/MRI system (1 Tesla) (Mediso). The respiration rate of the animals was monitored by pneumatic pad for the duration of the imaging session, and their body temperature was maintained by flow of warm air. Coronal T1-weighted images, used for anatomical reference and attenuation correction, were acquired using a three-dimensional gradient-recalled echo sequence (repetition time 22.5 ms; echo time 3.8 ms; flip angle 30°; data matrix, 256 × 256; slice thickness 0.70 mm; 48 slices). A 20-minute static PET image was then acquired, starting 70 minutes from the injection of [18F]TFB, as described previously32.
Images were reconstructed with Nucline software (Mediso) using T1-weighted three-dimensional gradient echo images for attenuation correction. PET/MRI data were analyzed using VivoQuant multimodality post-processing suite (Invicro). SUVmax was calculated with ROIs over the whole of the tumor volume.
SUVmax values were calculated using:
$$\mathrm{SUVmax}=\frac{{c}_{\mathrm{img}}}{ID/BW}$$
where cimg is the maximum voxel activity (MBq ml−1) in an ROI-based activity distribution; ID is the injected dose (MBq); and BW is the body weight of the animal (g). One milliliter of tissue was assumed to weigh 1 g.
Flow cytometry quantification
To quantify blood-derived immune cell populations expressing R26-mNIS-RFP-Luc2 under conditions of CMV-cre recombination, single-cell suspensions of blood (by cardiac puncture) were collected from NRL-CV, NRL and wild-type adult male and female mice and stained for flow cytometry. Antibodies used included CD3-BV785 (17A2; BD Biosciences, 564010), CD45-BV711 (30-F11; BioLegend, 103147), CD4-PE-Cy7 (RM4-4; BioLegend, 116016), CD8-BUV395 (53-6.7; BD Biosciences, 563786), CD19-BV605 (6D5; BioLegend, 115540), NKp46-BUV737 (29A1.4; BD Biosciences, 612805), LY6G-APC-Cy7 (1A8; BioLegend, 127623), CD11b-BV650 (M1/70; BioLegend, 101259), SiglecF-AF647 (E50-2440; BD Biosciences, 562680), CD64-PerCPCy5.5 (X54-5/7.1; BioLegend, 139308), TCRγδ-FITC (GL3; BioLegend, 118105) and CD11c-BV510 (N418; BioLegend, 117353) and counterstained with DAPI (Thermo Fisher Scientific, D1306). Samples were acquired on a BD Fortessa instrument. Data were analyzed using FlowJo version 10.8.1. For cell gating, RFP+ cells were subgated out of CD45+DAPI− single, and the immune subsets were subgated out of the RFP+ gate (Extended Data Table 2 and Extended Data Fig. 4a).
PCLSs
NRL-KP mice were humanely killed by intraperitoneal injection of sodium-pentobarbital, and, after instillation of 1.1 ml of low-melting-point agarose (2% in PBS w/v; Merck) through the trachea using a customized blunted 22-gauge needle, lungs were excised en bloc. Lungs were sliced into 300-µm-thick sections on a vibrating microtome (Campden Ltd.) either fixed in 4% formaldehyde in PBS (VWR) for 24 hours at 4 °C or fresh for immediate live imaging. Fixed slices were permeabilized and blocked in PBS with 0.3% Triton-X (Sigma-Aldrich), 10% normal goat serum (Sigma-Aldrich), 1% bovine serum albumin (BSA) (Sigma-Aldrich) and 0.001% sodium-azide (VWR); stained with hamster anti-CD31 (clone 2H8; Abcam); and then stained with anti-hamster AF488 (Jackson ImmunoResearch), anti-CD45 AF647 (BioLegend) and DAPI (Invitrogen). Finally, slices were mounted in Ce3D tissue clearing solution (BioLegend).
Whole-tissue sections were imaged to a depth of 195 μm (66 planes at 3-μm separation) using an Opera Phenix high-throughput confocal microscope (Revvity) with a ×20 water objective, and analysis was carried out using Harmony 4.9 image analysis software (Revvity). Analyzed images were a maximum projection of all planes, flat-field corrected. The analysis sequences were tailored to each tissue section. Tumors were segmented on the basis of high DAPI (excitation 405 nm/emission 435−480 nm) intensity values, and, where threshold values did not accurately segment the tumor nuclei, we improved the accuracy of segmentation and excluded any normal tissue by adding a measurement of texture in the same channel, which exploits the disorganized appearance of the tumor, resulting in a smoother texture to the DAPI staining compared to normal tissue. TagRFP+ regions were defined as those where intensity (excitation 561 nm/emission 570−630 nm) was above background values for the section. CD45+ cells were segmented by intensity at 640 nm (emission 650−760 nm). Displayed images have, in addition, been autocontrasted.
Alternatively, fresh slices were stained with anti-CD31 AF647 (clone 390; BioLegend), anti-CD45 AF488 (clone 30-F11; BioLegend) and Hoechst 33342 (Thermo Fisher Scientific) in complete medium (phenol red-free DMEM supplemented with 1% FBS; Gibco) for 15 minutes at 37 °C. Slices were imaged on a Zeiss LSM 880 confocal microscope with Airyscan in a full incubation chamber at 37 °C with 5% CO2. Airyscan processing of time-lapse sequences was performed in Zeiss ZEN software before visualization with Imaris software (Bitplane; Oxford Instruments).
S-LIVM and liver IVM
Adult male and female NRL-KP and NRL-BM mice were injected intravenously with fluorescently conjugated monoclonal antibody against CD31 (AF488) and CD45 (AF647). NRL-KP mice were humanely killed by intraperitoneal injection of pentobarbital (Euthatal). After confirmation of death by severing the femoral artery, NRL-KP mice were mechanically ventilated (PhysioSuite; Kent Scientific) with room air at 10 ml kg−1 stroke volume and 150 breaths per minute with 0.1 cm g−1 positive end-expiratory pressure (PEEP). A custom-built flanged vacuum chamber with an 8-mm glass coverslip was inserted via a 5-mm incision between two ribs above the left lung lobe. The location was previously identified using PET/MRI and BLI and was marked in black ink. NRL-BM mice were anesthetized using isoflurane (induction with 3% in 2 l min−1, approximately 95% O2/5% N2, reducing to 1.5% for maintenance). After confirmation of surgical anesthesia, a surgical window was opened through the skin and peritoneal membrane above the liver45. A custom-built vacuum chamber was then placed above the liver. In both models, minimal suction (0.1–0.2 bar) was used to stabilize the lung or liver against the coverslip. Imaging was performed on an upright LSM 880 NLO two-photon confocal microscope (Zeiss) using a ×20, 1 numerical aperture long-working-distance water immersion objective. Signals from the different fluorophores were captured simultaneously in three channels by optimizing the emission wavelengths captured by photomultiplier tube (PMT) 1 (AF488), Gallium Arsenide Phosphide array (configured as a single detector 2; TagRFP) and PMT2 (AF647). Four-dimensional data were acquired by performing timelapse, z-stack acquisitions over a volume with approximately 30 µm depth in 8–10 z-slices.
In situ hybridization
Animals were euthanized by CO2 inhalation unless stated otherwise. Tissues of interest were rapidly excised and fixed in 10% neutral buffered formalin (Sigma-Aldrich, HT501128) changed to 70% ethanol: 30% dH2O mixture after 24 hours and then paraffin embedded and stored at room temperature prior to sectioning. All in situ hybridization (ISH) staining was performed on 4-µm formalin-fixed paraffin-embedded (FFPE) sections that had previously been incubated at 60 °C for 2 hours. ISH detection for Mm-Slc5a5 (no. 487728), Mm-Ppib (no. 313918) and dapB (no. 312038) (Bio-Techne) mRNA was performed using RNAscope 2.5 LSx (Brown) detection kit (Bio-Techne, 322700) on a Leica Bond Rx autostainer according to the manufacturerʼs instructions. To complete the ISH staining, sections were rinsed in tap water, dehydrated through a graded ethanol series and placed in xylene. The stained sections were sealed with coverslips using DPX mountant in xylene (CellPath, SEA-1300-00A).
ISH image analysis
Slides were scanned at ×20 magnification using a Leica Aperio AT2 instrument and analyzed using the HALO image analysis platform (Indica Labs). The CytoNuclear version 1.6 macro was tuned to identify negative (N), weakly (W), moderately (M) or strongly (S) stained cells. H-score, defined below, was reported:
$${\rm{{H}{-}{score}}}=\frac{3S+2M+1W}{S+M+W+N}\times 100$$
Statistical analysis
GraphPad Prism (version 10) software was used to perform statistical analyses and to plot the data. In figures, error bars represent 1 s.d. unless otherwise stated. P value classifications are summarized as follows: P > 0.05 (not significant); *P < 0.05; **P < 0.01; ***P < 0.001. No statistical methods were used to predetermine sample sizes, but our sample sizes are similar to those reported in previous publications26,32. Data distribution was assumed to be normal, but this was not formally tested.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
