Patients
A total of 172 patients with newly diagnosed nodal PTCL, including ALK+ ALCL (n = 22), ALK-ALCL (n = 14), nTFHL (n = 102), and PTCL-NOS (n = 34), were enrolled in this study as the training cohort. Among them, 109 patients were classified as relapsed/refractory (R/R) and 63 patients as durable remission based on treatment response. The prognostic value of IRENA was further validated in an independent cohort of 36 patients with nodal PTCL from our previous study [19]. Pathological diagnoses were established according to the WHO classification [2].
Cell lines
Karpas299 (Human ALK-positive anaplastic large cell lymphoma), H9 (Cutaneous T cell lymphoma), Jurkat (Human T lymphocyte), and HEK 293 T (Human embryonic kidney cell) were obtained from the American Type Culture Collection (Manassas, VA, USA). DL40 (Human ALK-negative anaplastic large cell lymphoma) was purchased from the Japanese Collection of Research Bioresources Cell Bank (JCRB, Catalog No. JCRB1337). All cell lines were authenticated by short tandem repeat profiling and tested for mycoplasma contamination. Karpas299 and DL40 served as the primary PTCL models for core functional and mechanistic studies, while H9 and Jurkat were included as auxiliary T-cell lines for loss-of-function and gain-of-function assays, respectively. Karpas299, H9, and Jurkat cells were cultured in RPMI-1640 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. DL40 was cultured in RPMI-1640 supplemented with 20% FBS and 1% penicillin-streptomycin. HEK 293 T cells were cultured in Dulbecco’s Modified Eagle Medium supplemented with 10% FBS and 1% penicillin-streptomycin. All the cells were maintained at 37 °C in a humidified atmosphere containing 5% CO₂.
RNA extraction, cDNA synthesis, and quantitative PCR (RT-qPCR)
Total RNA was extracted from cultured cells using FastPure ®Cell/Tissue Total RNA Isolation Kit V2 (Vazyme, Nanjing, China). For cDNA synthesis, 1 μg of total RNA was treated with 4 μl of 4× gDNA wiper mix (Vazyme) in a 20 μl reaction volume and incubated at 42 °C for 2 min to remove residual genomic DNA. The reaction was then mixed with 4 μl of 5× HiScript III qRT SuperMix (Vazyme) and incubated at 37 °C for 15 minutes followed by 85 °C for 5 sec to synthesize cDNA. RT-qPCR was performed using the synthesized cDNA as templates, with Chamq Universal SYBR qPCR Master Mix (Vazyme) and the corresponding primers listed in Table. S1.
RNA-sequencing analysis
Tumor biopsies collected at diagnosis were subjected to RNA-seq analysis. RNA extraction, library construction, paired-end sequencing, and read alignment were performed as previously described [19, 20]. Differential gene expression analysis was performed using the limma R package to compare R/R and durable remission patients in the training cohort. Genes upregulated in the R/R group were identified based on a threshold of log2 fold change (FC) > 1.0 and adjusted p < 0.05. To identify genes associated with poor progression-free survival (PFS), we performed univariate Cox regression analysis using gene expression (log2(TPM + 1)) as a continuous variable, along with log-rank tests based on stratification by the mean expression level of each gene. Genes with a hazard ratio (HR) > 1 and p < 0.05 in both analyses were considered prognostically significant. For the Karpas299 cell line overexpressing IRENA compared to the vector control, differential expression genes were analyzed with edgeR package and subjected to KEGG pathway and GO enrichment analysis using the clusterProfiler package.
Whole exome sequencing and targeted sequencing
Whole exome sequencing (WES) and targeted next-generation sequencing (tNGS) were performed on genomic DNA samples obtained from Shanghai Ruijin Hospital. All sequencing procedures and subsequent bioinformatic analyses were conducted according to the protocols established in our previous study [19]. This study included 55 WES and 99 tNGS data. A total of 73 genes with recurrent mutations (frequency > 2%) were selected to assess their association with IRENA expression level (quantified by RNA sequencing), as summarized in Table. S4.
5’ and 3’ rapid amplification of cDNA Ends (RACE)
The SMARTer RACE 5’/3’ Kit (Takara Bio, Japan) was used to generate full-length IRENA cDNAs according to the manufacturer’s instructions. 1 μg of total RNA extracted from DL40 was reverse transcribed to cDNA using CDS primer and SMARTScribe Reverse Transcriptase. The cDNA was then amplified by nested PCR to increase specificity. The gene-specific primers used for PCR amplification were listed in Table S1. The PCR products were separated by agarose gel electrophoresis, purified, and cloned into the pRACE vector. The recombinant plasmids were then transformed into Stellar Competent E.coli cells, positive clones were selected, and the inserted RACE products were sequenced using M13 F/R primers.
RNA fluorescence in situ hybridization (FISH)
RNA Fluorescence In Situ Hybridization experiments were performed using the RNA in situ hybridization kit (Servicebio, Wuhan, China) according to the manufacturer’s instructions. The probe (5’-GTGCTTCTGAATCCAGCTTCTGTGCTGCCC-3’) was designed and synthesized by Servicebio. Briefly, DL40 and IRENA-overexpressing Karpas299 cells (5 × 104) were centrifuged onto glass slides using a cytospin. Cells were fixed with 4% paraformaldehyde and treated with protease K solution for protein digestion. Pre-hybridization was conducted with hybridization buffer at 37 °C for 1 h, followed by overnight hybridization at 37 °C either with the scrambled RNA probe or with the probe targeting IRENA. Post-hybridization washes were done with SSC buffers, then HRP-labeled anti-DIG antibody was applied and incubated at 37 °C for 1 h. Tyramide signal amplification (TSA) solution (FITC-Tyramide, Servicebio) was then added and incubated at room temperature in the dark for 10 min. Cells were counterstained with DAPI, and slides were mounted and imaged using a Leica TCS SP8 confocal microscope (Leica Microsystems, Germany).
Nuclear & Cytoplasmic RNA Isolation
Nuclear and cytoplasmic RNA were isolated from DL40 cells using Cytoplasmic & Nuclear RNA Purification Kit (Norgen Biotek Corp, Canada) according to the manufacturer’s instructions. Cells were lysed with lysis buffer J, and cytoplasmic RNA was separated by centrifugation. The supernatant was carefully transferred to a new 1.5 ml tube, processed with buffer SK and ethanol, and centrifuged through a spin column. The nuclear pellet was resuspended with buffer SK and ethanol, and also processed through a spin column. Both RNA fractions were washed with wash solution A, eluted with elution buffer E, measured for concentration, and used for downstream RT-qPCR analysis. GAPDH was used as the cytoplasmic marker and U6 as the nuclear marker, with primer information listed in Table S1.
Ectopic expression and gene knockdown by shRNA
IRENA 1649nt full-length cDNA was synthesized according to 5’ and 3’ RACE results and cloned into the pLXT-SFFV-puro vector. Two shRNA sequences targeting IRENA were individually cloned into the pLKO5-GFP-puro vector. shRNA targeting sequences are as below: sh#1 GCCAGGAGTGTCTGTTCTAAC; sh#2 AGGATGGTGAAG GTCTCTTTA. Lentiviruses were produced by transient PEI transfection of HEK 293 T cells with the psPAX2 and pMD2.G virus packaging plasmids, as well as the lentiviral expression vector that contained the sequence of interest. Virus was harvested by passing through a 0.45 mm filter and used directly to infect Karpas299, Jurkat, and DL40, H9 for ectopic expression and knockdown of IRENA, respectively. Infected cells were selected with puromycin at 0.5 μg/ml.
Cell viability assay
CCK-8 Cell Counting Kit (Vazyme) was used according to the manufacturer’s instructions. Cells from gain- and loss-of-function assays (Karpas299 VCT/OE, Jurkat VCT/OE, DL40 NT/shRNA1/shRNA2, H9 NT/shRNA1/shRNA2) were seeded into 96-well plates. After incubation for 0, 24, 48, and 72 h, 10 μl of CCK-8 solution was added to each well. The plates were then incubated at 37 °C for 2 h. Absorbance was measured at 450 nm using an Infinite 200 Pro Microplate Reader (Tecan, Switzerland).
Cell apoptosis
Cell apoptosis was conducted using the Annexin V-PE/7-AAD Apoptosis Detection Kit (Vazyme) following the manufacturer’s instructions. A total of 5 × 105 cells obtained from gain- and loss-of-function assays were harvested and stained with 5 μl of Annexin V-PE and 5 μl of 7-AAD Staining Solution. After a 10-minute incubation in the dark at RT, 400 μl of 1 × binding buffer was added to each sample. Flow cytometric analysis was performed using a Fortessa flow cytometer (BD Biosciences, CA, USA). Cells positive for Annexin V-PE alone were classified as early apoptotic, while those positive for both Annexin V-PE and 7-AAD were classified as late apoptotic or necrotic.
Cell cycle
A total of 1 × 106 cells from gain- and loss- of function assays were harvested and stained with propidium iodide using the Cell Cycle Staining Kit (MultiSciences Biotech, Hangzhou, China) according to the manufacturer’s instructions. Cell cycle analysis was performed using a Fortessa flow cytometer (BD Biosciences), and the data were analyzed by the FlowJo software.
Cytoskeletal and cytokinesis analysis
Karpas299 and DL40 cells from gain- and loss-of-function assays were seeded onto coverslips pre-coated with 0.1% poly-L-lysine, fixed with 4% paraformaldehyde, permeabilized with 0.2% Triton X-100, and blocked with 5% bovine serum albumin. F-actin was stained with phalloidin conjugated to Alexa Fluor 633 (MCE, Cat# HY-D1819, 1:200), and α-tubulin was detected using a primary antibody against α-tubulin (CST, Cat# 3873, 1:1000) followed by an Alexa Fluor 568-conjugated secondary antibody (Abcam, Cat# ab175473, 1:2000). Nuclei were counterstained with DAPI, and fluorescent signals were imaged using a confocal microscope. For quantitative analysis, at least 200 cells per condition were examined across four independent experiments. Cytokinetic cells were characterized by condensed nuclei and the presence of a visible midbody. Multinucleated cells were defined as those containing three or more nuclei.
In vitro transcription
In vitro transcription of IRENA RNA was performed using the MEGAscript®T7 Kit (Thermo Fisher Scientific, USA) with PCR products as DNA templates. DL40 cDNA was used as the template for PCR amplification with primers containing the T7 promoter sequence to synthesize sense and antisense IRENA, as well as truncated IRENA. All the primers used for in vitro transcription were listed in Table S1. The PCR products were purified using the Gel Extraction Kit (Vazyme) and used as DNA templates for in vitro transcription. The purified PCR products were added to transcription reactions and incubated at 37 °C for 6 h. The synthesized RNA was purified by lithium chloride precipitation. RNA integrity and size were assessed using the Denaturing RNA Electrophoresis Kit (MesGen, Shanghai, China) according to the manufacturer’s instructions.
RNA pulldown and mass spectrometry
Pierce Magnetic RNA-Protein Pull-down Kit (Thermo Fisher Scientific) was used for RNA pulldown assay according to the manufacturer’s instructions. In vitro transcripts, including sense, antisense IRENA, and truncated IRENA, were labeled with desthiobiotin at the 3’ end and incubated overnight at 16 °C. The labeled RNA was then purified using the GeneJet RNA Purification Kit (Thermo Fisher Scientific). Subsequently, 50 pmol of labeled RNA was incubated with 50 μl of streptavidin magnetic beads at room temperature for 30 min. The RNA-bound beads were then incubated with DL40 protein lysates at 4 °C for 1 h with rotation. Following incubation, the beads were washed, and RNA-protein complexes were eluted. The eluted proteins were boiled at 100 °C for 10 min before further analysis.
Following RNA pulldown, the protein samples were separated by SDS-PAGE. Silver staining was performed using a silver staining kit (Sangon Biotech, Shanghai, China) to visually compare band differences between the IRENA sense group and the anti-sense control group. Additionally, a portion of the protein samples was also separated by SDS-PAGE, running for approximately 15 minutes until the proteins reached the interface between the stacking gel and the separating gel. The gel was then stained with Coomassie Brilliant Blue (Byotime, Shanghai, China), and the desired bands were excised for mass spectrometry analysis (Novogene, Tianjin, China). Both silver staining and Coomassie Brilliant Blue staining were performed according to the manufacturers’ protocols. The remaining RNA pulldown samples were subjected to western blot analysis to confirm the interactions between IRENA and its target proteins.
RNA immunoprecipitation
The RNA immunoprecipitation (RIP) assay was performed using the PureBinding® RNA Immunoprecipitation Kit (Geneseed Biotech, Guangzhou, China) in DL40 cells. A total 1 × 107 of cells were lysed with an ice-cold lysis buffer A containing protease and RNase inhibitors. After reserving 50 μl of the lysates for protein input and 100 μl for RNA input, the remaining lysates were pre-cleared with Protein A + G beads. A total of 5 μg specific antibodies were incubated with 200 μl Protein A + G beads to form antibody-bead complexes, using rabbit IgG antibody as a negative control. The antibody-bead complexes were then incubated with the lysates at 4 °C overnight with rotation to capture RNA-protein complexes. Following incubation, the beads were washed. During the last wash, 10% of the beads were reserved for protein elution and subsequent western blot to verify successful pulldown of the target proteins. The remaining beads were used for RNA extraction via column purification for subsequent RT-qPCR analysis.
Co-immunoprecipitation
A total of 5×106 cells were lysed in ice-cold Pierce IP® Lysis Buffer (Thermo Fisher Scientific) containing protease and phosphatase inhibitors. To detect RHOA interactions, cells were serum-starved overnight and then stimulated with 10% FBS for 20 min prior to lysis. The cell lysates containing 1000 μg protein were then incubated with 5 μg primary antibodies overnight at 4 °C with gentle rotation. 25 μl PierceTM Protein A/G magnetic beads (Thermo Fisher Scientific) were added and incubated for an additional 1 h at RT with gentle rotation. After washing the beads thoroughly with lysis buffer, the bound proteins were eluted in 1 × Loading buffer (Epizyme, Shanghai, China), resolved by SDS-PAGE, and analyzed by immunoblotting. All the antibodies used in co-immunoprecipitation (Co-IP) assays were listed in Table. S2.
Western blot
Cells were lysed in 500 μl of Pierce IP® Lysis Buffer (Thermo Fisher Scientific) containing protease and phosphatase inhibitors. Protein concentrations were measured using the Enhanced BCA Protein Assay Kit (Beyotime). A total of 15 μg of proteins were loaded and separated on SDS-PAGE gels, followed by transfer to PVDF membranes (Millipore). Membranes were blocked in 5% non-fat dry milk in TBST and incubated with primary antibodies overnight at 4 °C. After washing using 1 × TBST, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Proteins were detected using ImmobilonTM Western Chemiluminescent HRP Substrate (Millipore) and visualized with a chemiluminescence imaging system. Bands’ intensities were quantified using ImageJ and normalized to ACTIN. All the antibodies used in this study are listed in Table S2.
RNA FISH and sequential immunofluorescence
Tissue sections from the Karpas299-OE cell-derived xenograft (CDX) tumors were dewaxed and rehydrated through a graded series of ethanol, followed by antigen retrieval in citrate buffer and digestion with Proteinase K. Subsequent steps for IRENA RNA FISH were performed as previously described. Following RNA FISH, sequential immunofluorescence was conducted as follows: the samples were blocked in 5% BSA for 1 h at room temperature to prevent nonspecific binding. Two primary antibodies, anti-rabbit ARHGEF1 (Proteintech, Cat# 11363-1-AP) and anti-mouse FMNL1 (Santa Cruz, Cat# sc-81274), were mixed and diluted at a ratio of 1:500, and the mixture was incubated with the samples overnight at 4 °C. The samples were then washed and incubated with secondary antibodies for 1 h at room temperature. After final washes, coverslips were mounted with a fluorescence-compatible mounting medium containing DAPI (Abcam, Cambridge, UK), and images were captured using an Ortho-fluorescent microscopy (Nikon Eclipse CI).
Multicolor immunofluorescence staining
Tissue sections from Karpas299-OE CDX tumors were deparaffinized and rehydrated using graded ethanol, followed by antigen retrieval and Proteinase K digestion. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide, and sections were blocked with 5% BSA. Sequential immunofluorescence staining was performed using primary antibodies against ARHGEF1 (Proteintech, Cat# 11363-1-AP, 1:500), FMNL1 (Santa Cruz, Cat# sc-81274, 1:500), and RHOA (CST, Cat# 2117, 1:1000), with overnight incubation at 4 °C in a humidified chamber for each antibody. After washing, secondary antibodies and TSA signal amplification solutions were applied. Between each staining cycle, antigen retrieval was repeated using citrate buffer. Nuclei were counterstained with DAPI, and fluorescent signals were imaged using a confocal microscope. All the antibodies used in this study are listed in Table S2.
RHOA activation assay
The RHOA activation assay was conducted using the Rho Activation Assay Biochem Kit (Cytoskeleton, Inc., CO, USA). Cells were first subjected to 24-hour serum starvation, followed by stimulation with 10% FBS for 20 minutes immediately prior to lysis. This process ensures that the cells are in a “responsive state” for optimal RHOA activation. Cells were then lysed rapidly on ice using an ice-cold lysis buffer containing protease inhibitors. The lysates were clarified by centrifugation, and protein concentration was measured and equalized to 0.5 mg/ml. For each sample, 10% of the lysate was reserved as input for a subsequent western blot to determine total RHOA levels. The remaining 800 μg of lysates were incubated with Rhotekin-RBD beads at 4 °C for 1 h with agitation. The beads were then washed and centrifuged, and the bound active RHOA was eluted by boiling in 2×Laemmli sample buffer. The eluted samples were analyzed by western blot using anti-RhoA monoclonal antibody (Cytoskeleton, Cat# ARH05, 1:1000). Quantification of RHOA activation was determined by comparing the signal intensity between different groups and normalizing with the total RHOA levels from the input samples.
Cell transient transfection
HEK 293 T cells were seeded in 12-well plates at 70–90% confluence. For ectopic overexpression of IRENA, ARHGEF1, FMNL1, and their truncated variants, the cells were transfected with appropriate plasmids using Lipofectamine 3000 (Invitrogen, CA, USA) according to the manufacturer’s instructions. For RHOA knockdown, Karpas299 cells were transfected with a negative control (siNC) and three siRNAs targeting RHOA using Lipofectamine 3000. Plasmids encoding HA-tagged-ARHGEF1, Flag-tagged-FMNL1, and their truncated variants, as well as siRNAs, were obtained from Xitu bio lnc (Shanghai, China).
In vivo xenograft murine models
Six-week-old female NOD/SCID mice (Strain NO. T001492) and NCG mice (Strain NO. T001475) were purchased from GemPharmatech (Nanjing, China) and housed under SPF conditions at the Experimental Animal Center of Ruijin Hospital affiliated with Shanghai Jiao Tong University School of Medicine. For xenograft models, 5 × 106 Karpas299 cells and 1.5 × 107 DL40 cells suspended in 200 μl PBS were injected subcutaneously into the right flank of NOD/SCID and NCG mice, respectively. When the tumor volume reached 100 mm³, mice from the IRENA OE group were paired by similar tumor volume. Within each pair, mice were randomized into ASO and vehicle arms. ASO (#GAGCTGAACACGTAAATGCC) was purchased from RiboBio Co., Ltd. (Guangzhou, China) and given by intratumoral injection (10 nmol each mouse) every other day. Tumors and mice’s body weight were measured every other day, and the tumor volume was calculated using the following formula: total tumor volume (mm3) = 0.5 × length × width2. No blinding was performed during the experiment or outcome assessment. After the final administration, all mice were sacrificed. Subcutaneous tumors and organs were harvested for further experiments.
Hematoxylin-eosin and immunohistochemical staining
Hematoxylin-eosin (HE) and immunohistochemical (IHC) staining were performed on 4 μm formalin-fixed, paraffin-embedded tissue sections. Sections were baked at 62 °C for 1 h, followed by deparaffinization in xylene and rehydration through a graded ethanol series. Endogenous peroxidase activity was blocked with hydrogen peroxide for 10 min at room temperature. Heat-induced antigen retrieval was performed in Tris-EDTA buffer (pH 9.0) at boiling temperature. After blocking with 5% BSA for 20 min, sections were incubated overnight at 4 °C with primary antibodies Ki67 (abcam, Cat# ab66155, 1:500) and Cleaved caspase-3 (CST, Cat# 8202, 1:1000). The following day, sections were incubated with secondary antibodies at 37 °C for 30 min. 3,3’-Diaminobenzidine was used for chromogenic detection, followed by hematoxylin counterstaining. Slides were dehydrated, cleared in xylene, and mounted with neutral balsam. Tissue sections were scanned using an Aperio GT 450 slide scanner (Leica Biosystems), and images were analyzed using QuPath software.
Statistical analysis
Statistical analyses were performed using GraphPad Prism (version 10) and RStudio (version 4.3.0). Kaplan-Meier analysis with the log-rank test was used to compare PFS between patients stratified into high- and low-expression groups according to the optimal cutoff value of log₂(TPM + 1) determined by receiver operating characteristic (ROC) curve analysis. Univariate and multivariate Cox regression analyses were conducted to elucidate the prognostic significance of lncRNA IRENA, with the hazard ratio (HR) threshold set at > 1. For comparisons between two groups, the Mann-Whitney U test was applied. For multiple comparisons, one-way ANOVA followed by Tukey’s post-hoc test was employed for data with equal variances, whereas the Kruskal-Wallis test with Dunn’s post-hoc test was used. Two-way ANOVA was applied for repeated-measures data, such as tumor growth curves and cell variability assays. For the analysis of associations between categorical variables, we utilized the Pearson’s Chi-square test or Fisher’s exact test, as appropriate. Statistical significance was set at p < 0.05. Data are presented as mean ± SEM. Sample sizes (3–6 biological replicates in vitro; 5-8 mice per group in vivo) were chosen based on common practice in the literature, without prespecified effect size or power analysis.
