Ethical approval and consent to participate
The collection of human biospecimens and the acquisition of data derived from them were conducted with ethical approval from the Institutional Review Board (IRB, P01-202004-31-005) of the Korea Research Institute of Bioscience and Biotechnology.
All animal housing and experiments conducted were in accordance with the Korea Research Institute of Bioscience and Biotechnology (KRIBB) Institutional Animal Care and Use Committee Guidelines (KRIBB-AEC-24058).
Development of the NOCS
NOCS, the multi-organ integrated MPS, was designed to mimic in vivo environments by integrating multiple organ components, circulating fluidics, nutrient uptake, and waste elimination. To construct each organ module, a multi-insert dish with a meshed bottom (SPL Life Sciences, #911606, Pocheon-si, Gyeonggi-do, Republic of Korea) and meshed sides (SPL Life Sciences, #911605) was used. To maintain a controlled microenvironment, a piezoelectric diaphragm pump (Takasago International Corporation, #SDMP306D, Yokohama, Kanagawa, Japan) and a weight load cell sensor (Cozy Electronics, #ZEL6J1-3kg, Ansan-si, Gyeonggi-do, Republic of Korea) precisely regulated the circulation of a common culture medium consisting of Advanced DMEM/F12 (Gibco, Thermo Fisher Scientific, #12634010, Waltham, MA, USA), N-2 supplement (Gibco, Thermo Fisher Scientific), B-27 supplement (Gibco, Thermo Fisher Scientific), 50 μg/ml Gentamycin (Gibco, Thermo Fisher Scientific, #15750060), GlutaMAX supplement (Gibco, Thermo Fisher Scientific, #35050061), and 1% penicillin/streptomycin (Gibco, Thermo Fisher Scientific, #15140122) across the system. The fluid velocity was maintained at 5 mL/min, ensuring efficient nutrient exchange and physiological shear stress, which are essential for preserving organoid function. Additionally, to prevent media stagnation and facilitate nutrient replenishment, two auxiliary pumps were programmed to activate for 2 min every hour at 2 mL/min, mimicking periodic fluid exchange observed in vivo. To further enhance physiological relevance, a brushless DC gear motor (BLDC, Xiangli, #BL3640A-24V-06P + RB35, Shanghai, China) was integrated into the main body of the system to induce orbital shaking. Detailed specifications for the equipment are provided in Supplementary Table 1.
Collection of BC biospecimens
Biospecimens were obtained from 14 women (mean age 60.2 years) who underwent breast cancer surgery and were provided by the Biobank of Chungnam University Hospital. Tissues from two patients were excluded due to yeast contamination. Of the remaining 12 patients, 10 were diagnosed with invasive ductal carcinoma, one with a malignant spindle cell tumor of the sarcoma type, and one with pleomorphic lobular carcinoma in situ. The collection of human biospecimens and the acquisition of data derived from them were conducted with ethical approval from the Institutional Review Board of the Korea Research Institute of Bioscience and Biotechnology. Informed consent was obtained from all biospecimen donors. The donor’s information of biospecimen is reported in Supplementary Tables 2.
Isolation and culture of primary cells from BC biospecimens
Tumor and adjacent normal tissue samples from breast mastectomy patients were washed with DPBS (Corning Inc., #21-031-CM) and minced into smaller pieces. For enzymatic digestion, 20–50 mg of tissue was incubated with 3 mL of 0.05% trypsin-EDTA (Gibco, #15400054) at 37 °C for 30 minutes. After digestion, 20 mL of DMEM with 5% FBS (Gibco, #16000044) was added, and the suspension was filtered through a 100 μm strainer (Corning Inc. #CLS431752). The flow-through was centrifuged, and the pellet was resuspended in MEGM (Lonza, #CC-3150) with 1 μM forskolin (Sigma-Aldrich), 1 μM Repsox (Sigma-Aldrich), 1 μM Y-27632 (Tocris Bioscience), 10 ng/mL R-SPO1 (PeproTech), and 1% P/S. The cells were seeded into T25 flasks, and after 24 h, the medium was changed every two days. Primary normal and tumor cells were maintained for up to five passages and verified by flow cytometry using EpCAM and CD49f antibodies (BD FACSVerse™).
Materials for Cell Culture
The 293 T cells were maintained in Dulbecco’s Modified Eagle’s Medium, low glucose (DMEM-low glucose, Gibco, Thermo Fisher Scientific, #11885084) supplemented with 10% FBS and 1% P/S in a humidified incubator at 37 °C with 5% CO₂. For the generation of the organoid model, DMEM/Ham’s F-12 (DMEM/F-12, #11320033), Advanced DMEM/F-12, Advanced Roswell Park Memorial Institute (RPMI) 1640 (#12633012), L-glutamine (#A2916801), 1 M HEPES (#15630080), B-27 supplement, and N-2 supplement were purchased from Thermo Fisher Scientific. RPMI 1640 medium (#10-040-LB) was purchased from Corning Inc.
Chemicals
All small molecules and selective inhibitors used in this study were purchased from Sigma-Aldrich or Selleckchem (Houston, TX, USA). Acyclovir and chlorothiazide were dissolved in dimethyl sulfoxide (DMSO, Sigma-Aldrich, #472301), while caffeine and acetaminophen were dissolved in water to the indicated stock concentrations. All selective inhibitors were dissolved in DMSO to the indicated stock concentrations. Detailed information on the chemicals, including stock and final working concentrations, is provided in Supplementary Table 3.
Establishment and maintenance of normal and BC Patient 1-derived hiPSCs
Patient 1 and healthy (normal, CRL 2097, ATCC) fibroblast-derived iPSCs were reprogrammed using the CytoTune-iPS 2.0 Sendai Reprogramming Kit (Invitrogen, Thermo Fisher Scientific). Fibroblasts (1 × 10⁵) were seeded in 6-well plates for 24 h, then transduced with Sendai virus carrying reprogramming genes (OCT4, SOX2, KLF4, L-MYC) according to the manufacturer’s recommendations. After 5 days, detached fibroblasts were re-seeded onto mitomycin C (AG scientific, San Diego, CA, USA, #M-1108)-treated mouse embryonic fibroblasts and cultured for 14 days in reprogramming medium [DMEM/F12, 1 mM MEM Non-Essential Amino Acids Solution (NEAAs, Gibco, Thermo Fisher Scientific, #11140035), 1% P/S, 0.1 mM 2-Mercaptoethanol (Gibco, Thermo Fisher Scientific, #21985023), 20% KnockOut™ Serum Replacement (KSR, Gibco, Thermo Fisher Scientific, #10828028), and 20 ng/ml basic fibroblast growth factor (bFGF, R&D Systems, #233-FB, Minneapolis, MN, USA)]. Single colonies were picked, expanded, and dissociated into clumps using 1 mg/mL collagenase type IV (Gibco, Thermo Fisher Scientific, #17104019).
Identification of the NF1 mutant allele in BC Patient 1-derived hiPSCs
To validate the genetic background of the NF1 mutation in BC patient-derived hiPSCs compared to BC tissues, genomic DNA was extracted from normal and patient-derived hiPSCs using the DNeasy Blood & Tissue Kit (QIAGEN, #69504, Hilden, Germany) according to the manufacturer’s instructions. The exon 2 region of NF1 was amplified by PCR, and the PCR products were cloned into a TA cloning vector. After TA cloning, the NF1 mutation in patient-derived hiPSCs was verified by sequencing, and the results were compared to the WES analysis of the patient tissue. WES analysis was conducted by Theragen Bio (Suwon, Republic of Korea) using standard next-generation sequencing technology.
Generation of small intestine organoid (IO) from hiPSCs and isolation of ISCs
The differentiation of human normal and BC patient 1-derived iPSCs into hIOs, and the isolation of proliferative ISCs, were performed as previously described.27 Briefly, hiPSCs were differentiated into DE by treatment with 100 ng/mL Activin A (Novus Biologicals) for 3 days in RPMI 1640 medium with increasing concentrations of fetal bovine serum (FBS). The DE cells were then cultured in RPMI 1640 medium with 2% FBS, 500 ng/mL FGF4 (PeproTech), and 500 ng/mL WNT3A (R&D Systems) to form mid-hindgut cells. These cells formed 3D spheres, which were embedded in Matrigel (Corning Inc.) and cultured in hIO medium [Advanced DMEM/F-12, 2% B-27, 100 ng/mL EGF, and 100 ng/mL Noggin].
For ISC isolation, hIOs were removed from Matrigel and gently pipetted to eliminate residual fragments. Organoids were digested in 1 mL of 0.25% trypsin-EDTA for 5 minutes at 37 °C and dissociated into small clumps. Digestion was stopped with 10 mL of ISC basal medium [Advanced DMEM/F-12 with 2mM L-glutamine, 15 mM HEPES, and 1% P/S], followed by centrifugation at 800 × g for 3 minutes. The pellet was resuspended in ISC growth medium containing 1 μM Jagged-1 (Anaspec) and 10 μM Y27632 (Tocris Bioscience), along with 2% B-27, 10 nM [Leu15]-Gastrin I, 100 ng/mL WNT3A, EGF, and Noggin, 500ng/mL R-Spondin 1, 500 nM A83-01 (Tocris Bioscience), 10 μM SB202190, 2.5 μM PGE2, 1mM N-acetyl L-cysteine, and 10 mM nicotinamide (Sigma-Aldrich), prepared in ISC basal medium. Medium was refreshed every other day, and cells were passaged at a 1:3 ratio upon reaching 80–90% confluency. Detailed information on the reagents used for hIOs generation is provided in Supplementary Table 4.
Generation of hIECs model using ALI culture
To generate the hIECs model, ISCs were seeded onto 12-well transwell plates to establish polarized cultures. Transwell membranes were pre-coated with 1% Matrigel in cold ISC basal medium and incubated for 1 hour at 37 °C. ISCs were washed with PBS, dissociated using 0.25% trypsin-EDTA for 8 minutes at 37 °C, and centrifuged. A total of 3.5 × 10⁵ cells were seeded into each insert with ISC growth medium. After reaching confluency, the apical medium was removed to initiate ALI conditions, and the basal medium was replaced every 2 days. ALI cultures were maintained for 6–10 days to promote epithelial differentiation. Detailed information on the reagents used for liver organoid generation is provided in Supplementary Table 4.
Generation of hLOs from hiPSCs
Differentiation of human normal and BC patient 1-derived iPSCs into hepatic-like organoids (hLOs) was performed as previously described.28 Briefly, iPSCs were treated with 100 ng/mL Activin A (Thermo Fisher Scientific) in RPMI 1640 with 2% B-27 for 6 days to induce DE. For HE induction, DE cells were cultured for 4 days under hypoxic conditions in RPMI 1640 with 2% B-27 minus insulin (Gibco, Thermo Fisher Scientific), 25 ng/mL BMP4, and 10 ng/mL bFGF (PeproTech). Detached HE cells were embedded in Matrigel and cultured in hepatic medium (HM) composed of advanced DMEM/F12 with 1% P/S, 1 mM GlutaMax, 1 mM HEPES, 1% N-2, 2% B-27 without vitamin A, 1% ITS, 50 ng/mL EGF, 25 ng/mL HGF, 10 ng/mL bFGF, 10 ng/mL Oncostatin M (R&D Systems), 5 μM A83-01, 10 μM forskolin (Sigma-Aldrich), 1mM N-acetyl L-cysteine, 10 nM Leu15-gastrin I, 10 mM nicotinamide, and 100 nM dexamethasone (Sigma-Aldrich). Organoids were expanded in Matrigel domes with HM refreshed every 2–3 days and passaged weekly at a 1:4–1:10 ratio.
For differentiation, one day post-passaging, HM was replaced with expansion medium (EM), composed of advanced DMEM/F12 with 1% P/S, 1 mM GlutaMax, 1 mM HEPES, 1% N-2, 2% B-27 without vitamin A, 50 ng/mL EGF, 25 ng/mL HGF, 100 ng/mL FGF10, 1mg/mL R-spondin 1, 25 ng/mL BMP7 (PeproTech), 5 μM A83-01, 10 μM forskolin, 1mM N-acetyl L-cysteine, 10 mM nicotinamide, and 10 nM Leu15-gastrin I. After 3 days in EM, the medium was replaced with differentiation medium (DM) containing advanced DMEM/F12, 1% P/S, 1 mM GlutaMax, 1 mM HEPES, 1% N-2, 2% B-27 with vitamin A, 25 ng/mL HGF, 0.5 μM A83-01, 100 ng/mL FGF19 (PeproTech), 100 ng/mL BMP7, 1mM N-acetyl L-cysteine, 10 nM Leu15-gastrin I, and 3 μM dexamethasone. Organoids were maintained in DM for 6 days with medium changes every 2 days. Reagent details are provided in Supplementary Table 4.
Generation of KOs from iPSCs
To generate KOs, human normal and BC patient 1-derived iPSCs were seeded on Matrigel-coated flasks and cultured in mTeSR1 medium (STEMCELL Technologies, #85850). When cells reached ~30–40% confluency (day 1–2), primitive streak (PS) induction was initiated using Advanced RPMI 1640 (Gibco, Thermo Fisher Scientific) supplemented with antibiotic–antimycotic (Gibco, #15240062), NEAAs, GlutaMax, B-27, and 8 μM CHIR99021 (Tocris Bioscience) for 4 days. For BC iPSCs, 1 μM Y-27632 was also included.
From days 5–7, cells were treated with 100 ng/mL FGF9 (PeproTech), 1 μg/mL heparin (Sigma-Aldrich), and 0.1 μM RA (Sigma-Aldrich, days 5–6 only) to induce intermediate mesoderm (IM). IM cells were dissociated using Accutase (STEMCELL Technologies, #07920), and 1 × 10⁵ cells/well were seeded into ultra-low attachment 96-well plates (Corning, #CLS7007), centrifuged (800 × g, 2 min), and cultured with FGF9, heparin, and 5 μM Y-27632 for 1 day. Aggregates (5–6/well) were transferred to collagen-coated transwell inserts (Corning, #3491), treated with 5 μM CHIR99021 for 1 h, then cultured in differentiation medium containing 100 ng/mL FGF9 and 100 ng/mL BMP7 (PeproTech) for 10–14 days with daily medium changes, avoiding overflow onto the apical surface.47
Generation of hKORTECs Model from hKTOs
KO-derived iPSCs were dissociated using Gentle Cell Dissociation Reagent (STEMCELL Technologies, #100-0485) for 10 min at 37 °C. Tubular segments and single cells were embedded in Matrigel and cultured in DMEM/F12 supplemented with 1.5% B-27, 1 μM N-acetyl L-cysteine, 5 μM A83-01, 100ng/mL R-spondin 1, 50 ng/mL FGF10 (PeproTech), 50 ng/mL EGF, 50 ng/mL BMP7, and 10 μM Y-27632. Medium was changed every 2 days, and tubule-like organoids appeared within 7–14 days. Organoids were passaged weekly.
For hKORTECs, ~250,000 cells from tubule organoids were seeded onto SPLInsert™ Hanging 24-well plates (SPL Life Science, #36124) and cultured in kidney tubule organoid medium. Upon confluency, the apical medium was removed to initiate ALI conditions while preventing overflow onto the membrane. Reagent details are provided in Supplementary Table 4.
Generation of BC patient 1-derived tumor spheroid model
Primary multicellular cells were isolated from the tumor and matched normal breast tissues obtained from patients with breast cancer. Cells were cultured in Mammary Epithelial Growth Medium (MEGM; Lonza, Basel, Switzerland, # CC-3150) supplemented with 1 μM forskolin, 1 μM RepSox, 1 μM Y-27632, 10 ng/mL recombinant human R-Spondin1, and 2% Matrigel (Corning Inc., #354234). Cell suspensions were placed in 15-mL SFU tubes (SPL Life Science, #911604) and subjected to rotation culture at 37 °C in 5% CO₂ incubator for 48 hours to induce multicellular aggregate formation. Following aggregation, cell clusters were embedded in a 3D extracellular matrix composed of type I collagen (Gibco, Thermo Fisher Scientific, #A10644-01) and Matrigel mixed at a 7:3 volume ratio. The embedded aggregates were transferred into ultra-low attachment 6-well plates (Corning Inc., # CLS3471) and maintained in suspension culture with MEGM for an additional 3–5 days at 37 °C under 5% CO₂. The resulting spheroids were used for subsequent functional and histological analyses.
In vitro three germ layer differentiation
To assess the differentiation potential, BC patient-derived iPSCs were detached using 1 mg/mL Collagenase Type IV and 1 mg/mL Dispase II (Gibco, Thermo Fisher Scientific, #17105041). The cell colonies were transferred to Petri dishes (SPL Life Science) and cultured in embryoid body (EB) differentiation medium containing DMEM/F-12 and 10% KSR for 5 days. Formed EBs were then re-plated onto 5% Matrigel-coated 4-well plates (Thermo Fisher Scientific, #167063) and cultured for an additional 10 days.
Cells were subsequently analyzed for germ layer-specific differentiation by immunostaining, the proportion of positive cells was quantified using ImageJ (version 1.53e), and RT-qPCR using ectoderm, mesoderm, and endoderm markers. Antibody and primer details are provided in Supplementary Tables 5 and 7.
Immunocytochemical analysis
hiPSCs and organoids were fixed with 4% paraformaldehyde at 4 °C overnight, then washed with PBS (Welgene). Samples were incubated with primary antibodies at 4 °C overnight, followed by Alexa Fluor®-conjugated secondary antibodies for 1 h at 25 °C in the dark. Organoids were washed with PBS containing 0.05% Tween-20 between steps. Nuclei were stained with Hoechst 33342 (Invitrogen) and slides mounted using Fluoromount™ Aqueous Mounting Medium (Sigma-Aldrich, #F4680). Images were captured using a confocal microscope (LSM 800, ZEISS) or EVOS FL Auto microscope (Thermo Fisher Scientific) and analyzed with ImageJ (version 1.53e).
Alkaline phosphatase (AP) staining and Immunostaining
hiPSCs were stained using the AP Detection Kit (Sigma-Aldrich) following the manufacturer’s instructions. For immunostaining, cells were washed with PBS and fixed with 4% paraformaldehyde for 15 min at 25 °C, followed by permeabilization with PBS containing 0.1% Triton X-100 for 15 min. After blocking with 4% BSA (Bovogen Biologicals, Keilor East, VIC, Australia, #BSAS-AU) for 1 h at 25 °C, cells were incubated with primary antibodies overnight at 4 °C. The next day, samples were washed with PBS containing 0.05% Tween-20 and incubated with fluorescence-conjugated secondary antibodies for 1 h at 25 °C. Nuclei were stained with DAPI (BD Biosciences, San Jose, CA, USA, #564907) and visualized using a fluorescence microscope (IX71, Olympus Corporation, Tokyo, Japan). Reagents and kits are listed in Supplementary Table 6.
RNA preparation, cDNA synthesis, and quantitative real-time PCR
Total RNA from hiPSCs and differentiated cells was extracted using the RNeasy Mini Kit (QIAGEN, #74106). cDNA was synthesized using the SuperScript™ IV First-Strand Synthesis System (Invitrogen, Thermo Fisher Scientific, #18091200). qPCR was performed using SYBR™ Green PCR Master Mix (Applied Biosystems, Thermo Fisher Scientific, #43-091-55) on a 7500 Fast Real-Time PCR System (Applied Biosystems). Gene expression levels were analyzed using the ΔΔCt method. Primer sequences are listed in Supplementary Table 7.
Short tandem repeat (STR) analysis and Karyotype analysis
Genomic DNA was extracted from breast cancer fibroblasts and hiPSCs using the DNeasy Blood & Tissue Kit. STR analysis was performed by HumanPass Inc. (Seoul, Republic of Korea), and G-banding karyotype analysis of cultured hiPSCs was conducted by GenDix Inc. (Seoul, Republic of Korea).
TEER Measurement
To assess barrier integrity and functionality of the hIEC and KORTEC models, TEER was measured using an epithelial volt/ohm meter (EVOM2, World Precision Instruments, Sarasota, FL, USA) according to the manufacturer’s instructions. TEER was assessed both to evaluate the functional properties of the models and to determine the impact of drug treatment on epithelial barrier toxicity.
Dextran uptake assay
To evaluate the paracellular permeability of the hIECs model, FITC-conjugated dextrans (4 kDa, Chondrex Inc., #4013; 40 kDa, Chondrex Inc., #4009) were used. The hIEC models were washed with PBS and treated with HBSS (Thermo Fisher Scientific, #14025092) containing 6.25 μM of each FITC-dextran in the apical compartment. After a 30-minute incubation at 37 °C in a 5% CO2 incubator, the basal solution was collected for fluorescence analysis using a multi-mode microplate reader (SpectraMax i3x, Molecular Devices).
For the hKORTECs model, FITC-labeled dextran (3 kDa, Invitrogen, Thermo Fisher Scientific, #D3306) was added to the apical compartment at a final concentration of 0.1 mg/ml. At 30, 60, 120, 240, and 360 minutes, 100 μl of medium was collected from both apical and basolateral compartments. Fluorescence intensity was measured using a multi-mode microplate reader.
Measurement of ALB, AST, and ALT
To quantify ALB, ALT, and AST, organoid culture supernatants were collected after 24 hours, and the concentrations of secreted ALB, ALT, and AST were measured using Human Albumin (Bethyl Laboratories, Montgomery, TX, USA), ALT (Abcam, Cambridge, UK), and AST (Abcam) ELISA kits according to the manufacturer’s instructions. Absorbance was measured using a microplate reader. A list of the ELISA kits used in this study is provided in Supplementary Table 6.
Uptake of CLF
To measure CLF polarity, organoids were removed from the Matrigel by washing with PBS and incubated with culture medium supplemented with 10 μg/ml CLF (Corning Inc.) and 1 μg/ml Hoechst 33342 for 30 minutes at 37 °C in a 5% CO2 incubator. After incubation, the dye was removed, and the DhLOs were gently washed twice with cold PBS containing calcium and magnesium (Gibco, Thermo Fisher Scientific, #10010023). Culture medium was then added, and the DhLOs were photographed under a confocal microscope (LSM 800, ZEISS).
Measurement of cytochrome P450 (CYP) enzyme and CYP450 reductase (CPR) activity assay
CPR activity in the hIECs was evaluated using the Cytochrome P450 Reductase Assay Kit (Abcam, #ab204704) according to the manufacturer’s instructions. Standard and reaction wells were prepared with appropriate volumes of samples, inhibitors, or controls, followed by the addition of reaction mix and 20 mM G6P solution. After 30 minutes of incubation at 25 °C, CPR activity was measured using a colorimetric microplate reader.
To assess CYP enzyme activity in the DhLOs model, specific CYP enzymes were induced with inducers: 20 μM rifampicin for CYP2C8, CYP2C9, CYP2C19, and CYP3A4, and 100 μM omeprazole for CYP1A2. CYP family activity was analyzed using a P450-Glo assay kit (Promega Corporation) and measured with a GloMax Navigator Microplate Luminometer (Promega Corporation). The results were normalized to total cell count using a TC20 Automated Cell Counter (Bio-Rad Laboratories) and expressed as enzyme activity per 1 × 10⁶ cells.
Assessment of Albumin Uptake and MRP2/4 Transport Function in the hKORTECs
For albumin uptake assessment, FITC-labeled albumin (Invitrogen, Thermo Fisher Scientific, #A23015) was added to the apical compartment at a final concentration of 0.2 mg/ml. After 6 hours, samples were collected from both the apical and basolateral compartments, and the fluorescence was measured using a multi-mode microplate reader.
For the MRP2/4 transport assay, 10 μM CDFDA (Sigma-Aldrich, #21879) ± 20 μM MK-571 (Sigma-Aldrich, #M7571) in serum-free medium was added to the basolateral compartment, and serum-free medium ± 20 μM MK-571 was added to the apical compartment. Cells were incubated at 37 °C for 2 hours, and samples were collected from the basolateral compartment and the fluorescence was measured using a multi-mode microplate reader.
Functional analysis of drug transporters in hKORTECs
For nephrotoxicity and drug transporter activity assays, hKORTECs were exposed to 20 μM cisplatin (Sigma-Aldrich) with/without 1 mM cimetidine (Sigma-Aldrich) for 24 hours and the apoptosis profile was examined in the hKORTECs. For the apoptosis assay, cells were harvested and incubated with 100 μl of Muse Annexin V & Dead Cell Reagent (Millipore, Bedford, MA, USA) for 20 minutes at room temperature. Apoptosis was determined using the Muse Cell Analyzer (Millipore), and the statistics were presented as percentages of the cells that were alive, apoptotic, or dead.
Tissue Processing
Human breast tumor and normal tissues, mouse xenografts, and major organs were fixed in 10% formalin (Sigma-Aldrich, #HT501128) for 4–6 hours at 25 °C. The tissues were then placed in cassettes, thoroughly washed with water, and stored in 70% ethanol at 4 °C overnight until further processing. Tissue processing was performed according to a standard protocol, which included sequential dehydration steps: 80% ethanol for 1 hour at 25 °C, followed by 90% ethanol for 1 hour, 95% ethanol for 1 hour, and two rounds of 100% ethanol for 1 hour each. This was followed by three xylene treatments, each for 1 hour at 25 °C. Finally, tissues were infiltrated with paraffin wax overnight at 65 °C. Paraffin-embedded tissue samples were sectioned into 5–7 μm thick slices using a rotary microtome (Epredia, Thermo Fisher Scientific, Epredia™ HM 325) and mounted onto silane-coated histological slides (MUTO CHEMICALS CO., #5116-20 F, Tokyo, Japan) to enhance tissue adhesion.
Immunohistochemical (IHC) Analysis
Paraffin-embedded tissue slides were deparaffinized in xylene and rehydrated through graded ethanol. Endogenous peroxidase activity was blocked with 0.3% H₂O₂, followed by permeabilization with PBST (1× PBS containing 0.1% Triton X-100). Antigen retrieval was performed in 10 mM sodium citrate buffer with 0.05% Tween 20 using a microwave. After blocking with 2% normal horse serum, slides were incubated with primary antibodies overnight at 4 °C. Following PBST washes, biotinylated secondary antibodies were applied, followed by ABC reagent (Vector Laboratories, Inc., Newark, CA, USA, #PK-400) and DAB substrate (Vector Laboratories, Inc., #SK-4105). Nuclei were counterstained with DAPI. Images were captured using an inverted microscope (IX71, Olympus) and analyzed with cellSense software. Antibody details are listed in Supplementary Table 5.
Flow Cytometry (FACS) analysis
Primary cells isolated from the tumor and adjacent normal tissues were washed with ice-cold PBS containing 2% FBS and counted. A total of 2 × 10⁵ cells were stained with fluorochrome-conjugated antibodies (listed in Supplementary Table 5) in PBS with 2% FBS for 30 min at 4 °C in the dark, following the manufacturer’s protocol. Secondary antibody-only samples were used as negative controls. After staining, cells were washed and analyzed using a BD FACSVerse™ Cell Analyzer (BD Biosciences). EpCAM and CD49f were used to identify epithelial and stromal populations, respectively, while CD44 and CD24 were used to detect breast cancer stem cells.
Western Blot Analysis
Tissue samples were homogenized in RIPA buffer [50 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.5 mM EDTA, 1% NP-40, 0.1% SDS, 1 mM PMSF, and protease inhibitor cocktail (Roche, Basel, Switzerland)], and cells were directly lysed in RIPA buffer on ice for 15 min. The lysates were then clarified by centrifugation at 15,000 x g for 10 minutes at 4°C. Lysates were separated on 10–15% SDS-PAGE gels and transferred onto PVDF membranes (Merck Millipore, Burlington, MA, USA). Membranes were blocked in PBST containing 5% skim milk for 1 hour at 25 °C, incubated overnight at 4 °C with primary antibodies, and then with secondary antibodies in PBST with 0.1% skim milk for 1 hour at 25 °C. Protein bands were visualized using a chemiluminescence kit (Merck Millipore, #WBKLS0500) and quantified using Image J software. Antibodies used are listed in Supplementary Table 5.
Ras Activation Assay
Ras activity in tissues and isolated primary cells was assessed using the Active Ras Detection Kit (Cell Signaling Technology, Danvers, MA, USA) according to the manufacturer’s instructions. Briefly, homogenized tissues and cells were incubated in lysis buffer on ice, and centrifuged at 15,000 x g for 10 minutes at 4 °C to collect the supernatant. Cell lysates (500 µg of total protein) were pre-incubated with GTPγS or GDP for 15 minutes at 30 °C. The reaction was terminated by adding MgCl₂ to a final concentration of 60 mM. Lysates were incubated with 80 µg of GST-Raf-RBD pre-bound to glutathione-Sepharose in a spin column for 1 hour at 4 °C. After washing, the resin was incubated in 2 × reducing sample buffer containing 200 mM DTT for 2 minutes at 25 °C, followed by western blot analysis.
AON design for NF1 exon skipping and evaluation of exon skipping efficacy
For AON design, exon 2 of NF1 was selected as the target, and 13 different AON sequences were designed using Human Splicing Finder and Examine the Secondary Structure of mRNA software. To prevent the degradation of the newly generated transcript by nonsense-mediated decay, all AONs were chemically modified with 2′-O-methyl (2′OMe)-PS and synthesized by Bioneer (Daejeon, Republic of Korea).
For the exon skipping efficacy test, BC-derived primary cells (3 × 10⁵ cells per well) were seeded in a 6-well plate, and the most promising AON was selected by transfecting 300 nM AON using Lipofectamine™ RNAiMAX reagent (Invitrogen, Thermo Fisher Scientific, #13778075) according to the manufacturer’s instructions. At 48 hours post-transfection, cDNA was synthesized from total RNA extracted from AON-treated BC-derived primary cells. Exon skipping was assessed by conventional RT-PCR and visualized on a 3% agarose gel. Exon skipping was confirmed by Sanger sequencing, and the splicing band was quantified using ImageJ software. The sequences of AON and NF1 primers used in this study are provided in Supplementary Tables 8–10.
Lentiviral vector-mediated double-target U7 snRNA-AON constructs
The modified U7 snRNA-specific plasmids were generated using the Sf-U7snRNA-ESE-AS-NsiI vector purchased from Addgene (#190694, Watertown, MA, USA). The U7 snRNA plasmid contained a dual AON targeting exon 2, specifically the acceptor splice site and the internal ESE. The complementary sequence to the pre-mRNA was selected to promote NF1 exon skipping. AON-U7smOPT sequences were cloned into the Sf-U7snRNA vector using NsiI and SalI restriction sites by Cosmogenetech (Seoul, Republic of Korea). The AON sequences are provided in Supplementary Table 11.
Lentiviral vector production, titration, and transduction
For lentiviral vector production, 293 T cells were transfected with the packaging plasmid psPAX2, the viral envelope plasmid pMD2.G, and U7snRNA constructs using the Transporter™ 5 transfection reagent (Polysciences, Inc., Warrington, PA, USA, #26008) according to the manufacturer’s instructions. At 72 hours post-transfection, the medium containing lentiviral particles was harvested, filtered through a 0.45 µm syringe filter (Merck-Millipore), and concentrated by ultracentrifugation at 100,000 × g for 2 hours at 10 °C (Himac CP100WX, HITACHI, Tokyo, Japan). Lentivirus titers were measured using a qPCR lentivirus titer kit (Abm, BC, Canada) following the manufacturer’s protocol, and determined by transducing 293 T cells with serial dilutions in a 24-well plate. BC-derived primary cells (2 × 10⁶ cells per 10 cm dish) were transduced with infectious lentiviral particles at a multiplicity of infection (MOI) of 10 in the presence of 8 μg/ml polybrene (Santa Cruz, CA, USA, #sc-134220) for 48 hours.
Generation of Isogenic iPSCs with lentivirus-U7-AON2/12
Patient-derived iPSCs were transduced with lentiviral vectors expressing U7-AON2/12 or control (LV-zsG) at an MOI of 20 in the presence of 8 µg/mL polybrene. Single-cell clones were established and screened for successful NF1 exon 2 skipping to select stable isogenic iPSC lines. Integration of the lentiviral construct was confirmed by PCR amplification of the U7 promoter and WPRE region after 2 and 6 months of culture. Pluripotency of the established iPSC lines was confirmed by standard assays for iPSC markers and differentiation potential. The primers used in this study are provided in Supplementary Table 10.
Cell viability assay
Cell viability was assessed 72 hour after chemical treatment in the multi-organ integrated MPS. Cells were incubated with the EZ-CYTOX reagent (DoGenBio, Seoul, Republic of Korea, #EZ-1000) at 37 °C for 1 hour in a CO₂ incubator following the manufacturer’s protocol. The absorbance at 450 nm was then measured using a microplate reader.
RNA sequencing analysis
For total RNA sequencing analysis, the TrueSeq RNA Sample Preparation Kit V2 was used for RNA purification and library preparation with total RNA as input material. Sequencing was performed on the Illumina NextSeq 1000 platform (Illumina, San Diego, CA, USA) with a paired-end read length of 2 × 100 base pairs. Raw sequencing reads were trimmed using Cutadapt version 1.18 (https://cutadapt.readthedocs.io/en/stable/), with the parameters ‘-a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -AAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -m 50 -O 5’. Low-quality reads (Phred score below 20) were filtered out using Sickle v1.33 (https://github.com/najoshi/sickle), retaining sequences of at least 50 bp in length. The quality of the resulting paired-end reads was evaluated using FastQC version 0.11.4. Duplicate reads were assessed using the FastQC tool. Further quality filtering, including removal of poly-N and low-quality reads, was conducted using NGSQCToolkit version 2.3.3 (https://github.com/mjain-lab/NGSQCToolkit). Cleaned reads were aligned to the human reference genome GRCh38.97 (Accession number: GCA_000001405.27) using HISAT2 version 2.1.0 (https://daehwankimlab.github.io/hisat2/). Transcript abundance was calculated as fragments per kilobase of transcript per million mapped reads (FPKM) using StringTie version 2.2.1 (https://github.com/gpertea/stringtie), which also provided normalized expression values.
In vitro PK profiling in a NOCS
The common culture medium, consisting of Advanced DMEM/F12, 1 x N-2/B-27 supplement, 50 μg/ml Gentamycin (Gibco, Thermo Fisher Scientific, #15710064), 1x GlutaMAX, and 1% P/S, was added to the outer dish connected to the multi-insert dish containing the prepared models in the multi-organ integrated MPS. The MPS device was set with a flow rate of 5 ml per minute and a shaking speed of 0.8 revolutions per second. The input rate of fresh medium and the output rate for elimination mimicking were activated for 2 minutes every hour at 2 mL/min, respectively.
For the PK studies of chemicals in the multi-organ integrated MPS system, both oral and intravenous drug administration routes were employed. All compounds were tested at a final concentration of 10 μM or with DMSO as a control. For oral drugs, the compound was applied to the apical side of the absorption model, and samples were collected at 30 minute intervals up to 6 hours, followed by additional samples at 12, 24, 48, and 72 hours. For intravenous drugs, the compound was applied to the metabolism model, and samples were collected at the same time points as those for the oral drug. The concentration of the compounds in all samples was analyzed using LC-MS/MS, and PK parameters were obtained using PK solver version 2.0 software.
In vitro PD profiling in a NOCS
For the PD studies in the multi-organ integrated MPS system, Paxalisib was applied to the apical side of the intestinal model at a final concentration of 10 µM under the same conditions as the PK studies for 72 hours.
After the analysis, the cytotoxic effects on the intestine, liver, and kidney models were evaluated by measuring cell viability using the EZ-CYTOX reagent, and TEER measurements were performed in the intestine and kidney models to assess barrier integrity and cytotoxicity. Additionally, the intestine, liver, and kidney models were analyzed for model-specific cell types and injury markers by RT-qPCR analysis.
For the cancer model, AON-induced exon skipping was performed prior to model establishment. To evaluate the anti-cancer efficacy of the combination treatment with Paxalisib and AON-mediated exon skipping, cancer models were treated with Paxalisib and AON. PI3K-mTOR and apoptosis signaling pathways were analyzed by western blotting, and cell viability was assessed using the EZ-CYTOX reagent. Antibody and primer information is listed in Supplementary Table 5 and 7.
In vivo PK profiling using a rodent model
Animal studies
Specific pathogen-free (SPF) male ICR mice (8 weeks old) were purchased from JA BIO Co. (Suwon, Kyonggi, Republic of Korea) and maintained in an SPF environment at 23 ± 2 °C with a 12-hour light/dark cycle and 50 ± 10% relative humidity. Food and water were provided ad libitum. Mice were allowed to acclimatize for one week before the study. Mice in the oral administration group were fasted overnight and fed 4 hours after dosing. A single dose of Bimaralisib, Gedatolisib, or Paxalisib was administered i.v. (5 mg/kg) or p.o. (20 mg/kg) in a solution of dimethylacetamide/Tween 80/20% v/v 2-hydroxypropyl β-cyclodextrin in deionized water (1/1/8 v/v). Blood samples (~50 µL) were collected at predetermined time points via the saphenous vein into Sarstedt’s Microvette® capillary tubes (Sarstedt, Nümbrecht, Germany), centrifuged at 12,000 x g for 3 minutes, and stored frozen at -20°C until analysis.
Plasma sample preparation
Plasma samples (15 µL each) were transferred to PCR tubes (Axygen, Union City, USA). Four volumes of acetonitrile containing carbamazepine as the internal standard (IS) were added, vortexed for 10 minutes (Multi-Tube Vortexer, VWR International, West Chester, PA, USA), and sonicated for 30 minutes at room temperature. After centrifugation at 12,000 x g for 10 minutes, the supernatant was analyzed using a 4000 QQQ LC-MS/MS system (Applied Biosystems, Concord, Canada) in positive MRM mode. Pharmacokinetic parameters were calculated by noncompartmental analysis of plasma concentration-time profiles using Kinetica™ 4.4.1 (Thermo Fisher Scientific, Inc., Woburn, MA).
LC-MS/MS analysis
The LC-MS/MS system consisted of an Agilent 1200 series HPLC system (Agilent Technologies, Wilmington, DE) and a 4000 QQQ LC-MS/MS system (Applied Biosystems, Foster City, CA) equipped with a Turbo VTM ion spray source operated in the positive ion mode. Sample separation was performed on an Atlantis dC18 column (50 × 2.1 mm i.d., 3 µm; Waters, Milford, MA, USA) with a SecurityGuard™ C18 guard column (2.0 × 4.0 mm i.d.; Phenomenex, Torrance, CA, USA) maintained at 30 °C. The sample injection volume was 5 µL, and the flow rate was set of 0.4 mL/min. Mobile phase consisted of HPLC water (A) and acetonitrile (B), each containing 0.1% formic acid. The TurboIonSpray interface was operated in the positive ion mode at 5500 V. The detection was conducted using multiple reaction monitoring of the transitions of m/z 252 > 190 for Bimiralisib, m/z 616 > 488 for Gedatolisib, m/z 383 > 353 for Paxalisib, and m/z 237 > 194 for carbamazepine (IS). The retention times of Bimaralisib, Gedatolisib, and Paxalisib, and the IS were 3.27, 3.09, 3.28, and 3.23 min, respectively. The scan dwell time was set at 0.1 sec for every channel. Acquisition and analysis of data were performed with AnalystTM software (version 1.6.3, Applied Biosystems, Foster City, CA).
In vivo Xenograft assay
Female BALB/c nude mice (5 weeks old, n = 5 per group) were purchased from the Central Laboratory Animal Inc. (Seoul, Republic of Korea). Mice were subcutaneously injected with patient-derived tumor primary cells (passage <4, 5 × 10⁶ cells/100 µL). When tumors reached ~50 mm³ (20 days post-injection), mice received intra-tumoral injection of lentivirus (LV-zsG or LV-U7-AON2/12, 10⁹ TU/mouse), followed by oral administration of Paxalisib (10 mg/kg) every 3 days for 10 doses in a vehicle containing 10% DMSO and 10% Cremophor-EL, starting one day after viral injection. Body weight and general health were monitored throughout the 47-day study. At the endpoint, mice were sacrificed, and tumors and major organs were excised for weight measurement and further histological analyses.
Statistical analysis
Statistical analyses were performed using GraphPad Prism software (version 7.05, La Jolla, CA, USA). Data are presented as mean ± SEM. For comparisons between two groups, statistical significance was assessed using a two-tailed unpaired Student’s t-test. For experiments involving multiple factors, statistical analysis was performed using one-way or two-way ANOVA, followed by Tukey’s post hoc test for multiple comparisons. A p-value of < 0.05 was considered statistically significant.
