Animal ethics statement
All animal experiments were conducted in compliance with regional regulations and approved by the regional authority (Regierungspräsidium Karlsruhe, Germany) under permit numbers G-70/20 and G52-25. Housing conditions for the mice included a 12-hour light/12-hour dark cycle, an ambient temperature of 20–24 °C, and relative humidity of 45–65%. For xenograft experiments, a maximum tumor diameter of 1.5 cm was permitted by the ethics committee, and this limit was not exceeded in any experiment. For autochthonous liver tumor models, hydrodynamic tail vein injections were performed under standardized conditions, and animals were monitored carefully during post-injection recovery. Mice were regularly palpated and inspected for abdominal enlargement and general well-being. Animals were euthanized upon reaching predefined humane endpoint criteria in accordance with institutional and governmental regulations.
Patient tissues and ethics
Institutional Ethical Review Board approval was obtained from the local Ethical Committees of the Medical Universities of Heidelberg (S205-06) and of the University Medical Center Mainz (2025-18147) in compliance with the Helsinki Declaration.
Patient tissue samples were provided by the Surgery Department and Women´s Hospital of the University Hospital Heidelberg and the University Medical Center Mainz. For naive allogeneic T cells, peripheral blood of anonymous healthy donors was obtained from the “DRK-Blutspendedienst” in Mannheim, Germany. Buffy coats from anonymous healthy donors to obtain T cells for CAR-T experiments were obtained from the Zentrum für Klinische Transfusionsmedizin Tübingen (ZKT) and the Blutspendezentrale IKTZ Heidelberg, respectively located in Tübingen and Heidelberg. Consent of all patients was recorded prior to analysis. No compensation was provided. Sex, gender, age, and ethnicity were not explicitly considered.
Integrative in silico approach for CSP target identification
Human CSP-coding genes, encoding the respective CSPs annotated in the CSPA (N = 1492)21, were surveyed for their genomic status in a publicly available pan-cancer dataset (ICGC/TCGA) comprising copy number variation (CNV) data from 2703 patients22. The analysis was done via the online platform cBioPortal, using the Onco Query Language “GAIN AMP”61. This tool employs GISTIC 2.0, an algorithm that follows a statistical approach to identify significant copy-number alterations in cancer genomes62, assigning the following scores: −2 (homozygous deletion), −1 (heterozygous deletion), 0 (diploid state), 1 (copy-number gain) or 2 (high-level amplification). We considered amplified genes as those with assigned scores of 1 or 2. The chromosomal locations of the hits were retrieved using the BioMart data mining tool from Ensembl63. To identify tumor types with recurrent amplifications of chromosome 1q, publicly accessible copy number variation data from all cancer entities available at TCGA Firehose Legacy was explored with the Integrative Genomics Viewer Software (IGV)25,64. For cancer types with frequent chr1q amplification, the CNV status of the identified hits was surveyed in the corresponding datasets (HCC, n = 370; BRCA, n = 1080; LUAD, n = 516) via cBioPortal26,27,28. Next, differential expression analysis was performed using GEPIA229, a web server that contains RNA sequencing data from TCGA and GTEx projects65,66. The ANOVA method was employed to obtain differential expression data for all genes under study, depicting the mRNA expression in tumor (T) relative to corresponding normal (N) tissues – HCC (T:n = 369; N:n = 160), BRCA (T:n = 1085; N:n = 291), LUAD (T:n = 483; N:n = 347). Next, subcellular localization of differentially expressed CSPs was retrieved from online protein databases, such as UniProt30, HPA23,24, and Gene Ontology31. Focusing on MPZL1 as a CSP target, the correlation between its CNV status and mRNA expression levels in the same datasets was explored via cBioPortal, considering only samples with both data types available (HCC, n = 360; BRCA, n = 960; LUAD, n = 230). Additionally, the CNV status of MPZL1 in human cancer cell lines was retrieved from the Cancer Cell Line Encyclopedia67. Publicly available data from DepMap38 were analyzed to assess whether MPZL1 exhibits cancer driver–like properties by evaluating gene essentiality, dependency scores, and associations with cell proliferation across human cancer cell lines.
Cell culture
All human cancer cell lines were originally obtained from ATCC/DSMZ/JCRB and incubated at 37 °C with 5% CO2 and maintained in sterile conditions. Depending on the specific cell line, high-glucose Dulbecco′s Modified Eagle′s Medium (DMEM, Sigma-Aldrich) or Roswell Park Memorial Institute Medium (RPMI 1640, GibcoTM) was used, in every case supplemented with 10% FCS (GibcoTM) and 1% penicillin/streptomycin (10,000 U/mL penicillin and 10 mg/mL streptomycin, Sigma-Aldrich). All human liver and breast cancer cell lines, as well as U-87 MG and CFPAC-1, were cultured in DMEM medium, while all human lung cancer cell lines, as well as NALM6 and Molm13, were cultured in RPMI medium.
Murine liver cancer cell lines (KrasG12D; p53−/−) were derived from tumors generated via HTVI in female C57Bl/6 animals18. Murine cells were cultivated in DMEM, with 10%FBS and 1% penicillin/streptomycin on collagen-precoated (PureCol, Cell Systems; 0.05 mg/ml) dishes (Greiner).
Genetic modification of cancer cell lines
For CRISPR/Cas9-mediated knockout of MPZL1, sgRNAs were designed using the CHOPCHOP web tool68, and subsequently cloned into the pLentiCRISPR v2 vector69, as previously described70. For lentiviral overexpression of MPZL1, NEBuilder® HiFi DNA Assembly was used to introduce an MPZL1 PCR product, generated from pENTR223-MPZL1 (obtained from DKFZ core facility), into the pLenti6.2/V5-DEST vector. Lentivirus production, transduction of cancer cells, and antibiotic-based selection were performed as previously described70, generating isogenic cancer cell lines either lacking or overexpressing MPZL1 protein. Finally, the efficiency of genetic modification was assessed via immunoblotting.
-
sgMPZL1.1_top guide (5’ → 3’): CACCGGGGGGCCGACACTACTGT
-
sgMPZL1.1_bottom guide (5’ → 3’): AAACACACAGTAGTGTCGGCCCC
-
sgMPZL1.2_top guide (5’ → 3’): CACCGGCACCGACCACAGCCAGC
-
sgMPZL1.2_bottom guide (5’ → 3’): AAACGCGCTGGCTGTGGTCGGTG
Immunoblotting
Harvested cells were lysed in lysis buffer (Cell Signaling Technology), supplemented with protease (cOmpleteTM Mini, Roche) and phosphatase inhibitors, by incubation on ice for 30 minutes, followed by centrifugation at 16,000 × g to collect protein lysates. Quantification of protein was done using the Bradford reagent (Bio-Rad). Samples with equal concentration were prepared with Laemmli buffer70 and denatured by boiling at 95 °C for 5 minutes. 20 μg protein samples were separated via SDS-PAGE using manually cast polyacrylamide gels and EZ-Run™ protein ladder (Fisher BioReagents™) as an indicator of molecular weight. Separated proteins were transferred to ROTI®PVDF membranes (Carl Roth) via Western Blot. Membranes were then blocked for 1 hour in 5% Milk (Carl Roth), followed by incubation with the primary antibody overnight at 4 °C (Supplementary Table S5). The day after, membranes were washed with TBS/T buffer and incubated with the corresponding HRP-conjugated secondary antibody (Supplementary Table S6). for 1 hour at RT, followed by additional washing and chemiluminescent signal detection using the Clarity™ Western ECL Substrate (Bio-Rad) and ChemiDocTM Gel Imaging System (Bio-Rad). Quantification of protein bands was done via densitometry-based analysis with ImageJ, where the relative intensity of MPZL1 was normalized to that of Vinculin, used as a loading control.
Deglycosylation assay
Deglycosylation of protein lysates was achieved by treatment with PNGase F enzyme. First, denaturation reactions were prepared by mixing 20 µg of lysate and 1 µL of Glycoprotein Denaturing Buffer (NEB) in a final volume of 10 µL of H2O. Samples were then boiled at 100 °C for 10 minutes. Second, deglycosylation reactions were set up by adding 2 µL of GlycoBuffer (NEB), 2 µL of NP-40 (NEB), 6 µL of H2O, and 1 µL of PNGase F (NEB), followed by incubation at 37 °C for 1 hour. Non-deglycosylated samples were subjected to the same denaturation protocol as an internal experimental control. Samples were further analyzed via immunoblotting.
Proliferation assays
For the clonogenic assay, 1 × 103 cells were plated in triplicate into six-well plates and allowed to grow for 2 weeks, with regular medium exchange. The cell colonies were then fixed and stained with a 0.05% (w/v) crystal violet solution containing 1% formaldehyde. Plates were scanned to generate digital images using the Perfection V850 Pro scanner (Epson). For the short-term proliferation assay, 1 × 103 cells were seeded in triplicate into independent 96-well plates corresponding to the different time points (0, 24, 48, 72, and 96 hours). The readout was performed every 24 hours using CellTiter-Blue® (Promega), following the manufacturer’s instructions. After incubation for 4 hours at 37 °C, fluorescence intensity (560/590 nm) was measured using the EnSpire® Multimode Plate Reader (PerkinElmer). Time 0 was defined as the day after plating the cells, and the results normalized to this time point.
Cell fractionation assay
To investigate the subcellular localization of MPZL1, the MinuteTM Plasma Membrane Protein Isolation and Cell Fractionation Kit (Invent Biotechnologies) was used. Cells grown in 15 cm dishes were harvested and processed according to the manufacturer’s protocol. After multiple rounds of centrifugation and incubation in the buffers provided, the different protein fractions were obtained: cytosol, organelle membrane, and plasma membrane. Additionally, “whole cell lysates” from the same cell lines were prepared as experimental controls. Samples were analyzed via immunoblotting, using tubulin and Na/K-ATPase as markers for cytosolic and plasma membrane fractions, respectively.
MPZL1 CSP target in a human patient cohort
Thirteen samples of patient livers were obtained upon tissue surgical resection71,72. Copy number variation status of the MPZL1 gene was assessed via comparative genomic hybridization. Next, MPZL1 mRNA expression was evaluated based on microarray data71,72, while MPZL1 protein levels were assessed through immunoblotting.
Immunohistochemistry
IHC was performed as previously described70. Briefly, deparaffinization of tissues was achieved by incubating the slides in xylene, followed by rehydration using a descending series of alcohol and a washing step with water. For antigen retrieval, slides were boiled for 8 minutes in a pressure cooker using a sodium citrate buffer (10 mM trisodium citrate dihydrate, 0.5%(v/v) TWEEN 20, pH 6.0), followed by rinsing in water for 5 minutes to cool down. Next, endogenous HRP was blocked by a 10-minute incubation in 3% hydrogen peroxide diluted in H2O. The slides were then rinsed in water for another minute and washed twice for 2 minutes with PBS. Tissue sections were blocked for 1 hour at room temperature in 5% BSA (Carl Roth) containing 0.5% Triton X-100, followed by overnight incubation at 4 °C with the corresponding primary antibody diluted in blocking buffer (Supplementary Table S7). Then, the slides were washed three times with PBS containing 0.05% Triton X-100 for 5 minutes, and incubated with the corresponding ImmPRESS® HRP Horse IgG Polymer Detection Kit, Peroxidase (Anti-Rabbit or Anti-Mouse) (VectorLabs) for 30 mins at RT, again followed by three 5-mins washing steps with PBS/Triton X-100. The antibody signal was detected with ImmPACT® DAB/HRP substrate (VectorLabs), according to the manufacturer’s instructions, with the reaction time adjusted individually for each antibody. Counterstaining with hematoxylin solution (Carl Roth) was then carried out for 1 or 2 minutes to obtain improved staining contrast. The slides were rinsed with running water and dehydrated using an ascending alcohol series, finishing with xylene. When dried, the coverslips were mounted on the slides using Micromount® mounting media (Leica). Histological slides were scanned with the Hamamatsu NanoZoomer Digital Pathology (NDP) system, and visualized and analyzed using QuPath73 and FiJi ImageJ74 software.
Tissue microarray (TMA) analysis
The expression and subcellular localization of MPZL1 in primary human tissue were analyzed by IHC using TMAs, comprising cancer-specific and non-cancer tissue punches (Supplementary Table S8). The histochemical staining was quantified by an experienced pathologist using a scoring system to evaluate MPZL1 expression (MPZL1-score) on the surface of epithelial cells, where 0 indicates negative staining, 1 and 2 represent intermediate levels, and 3 corresponds to complete plasma membrane staining in >10% of the cells (Fig. 2d). Institutional Ethical Review Board approval was obtained at local Ethical Committees of the Medical Universities of Heidelberg (S205-06), in compliance with the Helsinki Declaration. Written informed consent was obtained from all individuals.
Generation of an antibody targeting MPZL1
The hybridoma technology was used to generate antibodies against the extracellular domain of MPLZ1 protein. Briefly, 6 mice (3 each from strain Balb/C or C57BL6/N) were immunized with the extracellular fragment of human MPZL1 protein (extracellular domain of human MPZL1 protein; aa 36-165: SALEV YTPKEIFVAN GTQGKLTCKF KSTSTTGGLT SVSWSFQPEG ADTTVSFFHY SQGQVYLGNY PPFKDRISWA GDLDKKDASI NIENMQFIHN GTYICDVKNP PDIVVQPGHI RLYVVEKENL PVFPV in E. coli (pQE-vector system, HIS tag) by 4 subcutaneous injections (day 0 with Freund’s Adjuvant complete, day 7 with Freund’s Adjuvant incomplete, day 28 and 32 with Quil A, day 33 test sera, day 34 fusion; The immune response was tested by Western blot using cell lysates form overexpressed hMPZL1 fused with a tag. B lymphocytes of the animal showing the strongest immune response in Western blotting were isolated and fused with immortal myeloma cells to generate hybridoma clones capable of producing unique monoclonal antibodies (mAbs), and the clones were evaluated via FACS. The identification of a positive clone was followed by two rounds of subcloning, and the most specific subclone against MPZL1 was selected. Subsequently, the RNA from this hybridoma was sequenced to identify the variable heavy (VH) and kappa light (VL) chains (Supplementary Table S9–12). These sequences were cloned in frame into two independent human backbone vectors coding for the constant heavy (CH) and kappa light (CL) chains75, respectively. Finally, PEI-mediated transfection of HEK293 cells with these two plasmids led to the production of MPZL1-ChAb, composed of a human constant domain and a mouse variable region
Cell viability assay
To evaluate cellular susceptibility to MPZL1-ChAb, 1 × 103 cells per well were seeded in a 96-well plate and allowed to attach for 24 hours. Consecutively, treatments with increasing concentrations of MPZL1-ChAb (0.05–100 μg/mL) were applied in triplicate, with DMEM medium as the negative control. The readout was performed after 72 hours using CellTiter-Blue® (Promega), following the manufacturer’s instructions. Fluorescence intensity (560/590 nm) was measured with the EnSpire® Multimode Plate Reader (PerkinElmer).
Cell surface staining and FACS analysis
Extracellular staining of MPZL1 in isogenic cancer cell lines was performed to evaluate the specificity of MPZL1-ChAb. Briefly, adherent cells were washed with PBS and incubated in Versene-EDTA (Lonza) at RT for 10 to 15 minutes prior to harvesting using FACS buffer (3% FCS in PBS). 3 × 105 cells per condition were transferred to previously annotated wells in a V-bottom 96-well plate. Upon washing, cells were stained with 100 µg/mL MPZL1-ChAb for 45 minutes at 4 °C. Next, cells were washed and stained with a secondary antibody (AF488® or APC anti-human IgG Fc, BioLegend) during 45 minutes at 4 °C in the dark. After a final washing step, cells were resuspended in 200 µL FACS buffer containing 1:1000 SYTOX® Blue (Invitrogen), and transferred to cell strainer snap cap FACS tubes (Corning) for FACS analysis using a BD LSRFortessa flow cytometer (BD Biosciences). As negative controls for specificity, all the experimental samples were stained in parallel with human IgG1 isotype (BioLengend) at the same concentration as the primary antibody. When CD19 staining was included, the samples underwent a third incubation round with PE anti-human CD19 antibody (BioLegend) during 20 min in the dark. The same protocol was followed to evaluate MPZL1 expression in cell lines from different cancer types, as well as in CAR-T cells. Data analysis was, in all cases, carried out with FlowJo v10.
FFPE tissue blocks and matched DTCs
Cryopreserved dissociated tumor cells (DTCs) and formalin-fixed paraffin-embedded (FFPE) tissue blocks from human breast tumors of five independent patients (Discovery Life Sciences) were used to investigate MPZL1 expression on the surface of cancer cells within the tumor architecture. Anonymous patients were named as: 8843, 4130, 8921, 2457, 8991. MPLZ1 expression on tissue slides obtained from the FFPE blocks was evaluated via IHC with MPZL1 commercial antibody. DTCs were thawed and stained with fluorochrome-conjugated MPZL1-ChAb to measure antibody binding capacity (ABC) on the cell surface via FACS analysis.
Measurement of ABC
To quantitatively measure the ABC in DTCs, both MPZL1-ChAb and human IgG isotype control (Invitrogen) were covalently labeled with the AF488® fluorochrome, using the AlexaFluorTM 488 protein labeling kit (Invitrogen), according to the manufacturer’s instructions. Following labeling and purification, the sample absorbance was determined utilizing a Nanodrop ND-1000 Spectrophotometer (Thermo Fisher Scientific), with wavelengths of 280 nm for the protein and 494 nm for the dye. The protein concentration and the degree of labeling (DOL), representing the moles of dye bound per mole of protein, where calculated following protocol provided in the kit. For cell surface staining, 1 × 105 DTCs per condition were used, with JIMT-1 and Molm13 cells included as positive and negative controls, respectively. All samples were first incubated with 5 µg/mL of Human BD Fc BlockTM (BD PharmingenTM) for 10 minutes at RT to minimize nonspecific antibody binding to Fc receptors. Directly afterwards, cells were incubated with 5 µg/mL of labeled antibody for 1 hour at 4 °C in the dark. After two washing steps with PBS, cells were resuspended in 200 µL FACS buffer containing 1:1000 of SYTOX® Blue (Invitrogen). Samples were acquired in a BD LSRFortessa flow cytometer (BD Biosciences). A calibration curve was built to correlate the instrument’s acquisition channels to standardized fluorescence intensity units known as MESF (molecules of equivalent soluble fluorochrome), employing the Quantum™ Alexa Fluor® 488 MESF kit (Bangs Laboratories), according to the manufacturer’s instructions. This calibration enabled the interpolation of MESF values from the median channel values obtained from the acquired samples. Finally, the ABC in each sample was calculated dividing the MESF value by the DOL value previously determined. Additionally, the ABC for the IgG isotype control was subtracted from that of the MPZL1-ChAb in each sample to account only for specific target binding. This method allowed to determine the binding efficiency of MPZL1-ChAb to patient cancer samples with various levels of MPZL1 expression on the cell surface of cancer cells.
Generation of MPZL1-specific CAR constructs
The scFv generated is composed of the variable regions of the heavy and light chains of MPZL1-ChAb (Supplementary Table S9-12), connected by a short linker peptide. Two distinct approaches were followed, resulting in VL + VH and VH + VL configurations, with two constructs designed for each combination. Briefly, MPZL1.24 and MPZL1.66 contain one additional amino acid at the C-terminus compared with MPZL1.23 and MPZL1.44, reflecting the inclusion of terminal nucleotides of the MPZL1-ChAb sequence whose coding status could not be unambiguously resolved during sequence verification. The MPZL1-scFv is preceded by a leader sequence and followed by a hinge-transmembrane region, along with the CD28 and CD3ζ domains. The construct also includes the expression of a reporter gene (LNGFR). Briefly, these components were incorporated into a SFGγ retroviral vector, which was used for the stable transfection of gpg29 (H29) fibroblasts (kindly provided by Michel Sadelain (Columbia University) to J.F76,77. The generated retroviral supernatants were employed to establish stable retrovirus-producing Phoenix-AMPHO cell lines, and the resulting supernatants utilized for the transduction of T cells77.
Isolation and expansion of human T cells
Buffy coats from anonymous healthy human donors were purchased from either the ZKT Tübingen or the IKTZ Heidelberg (Zentrum für Klinische Transfusionsmedizin, and Institut für Klinische Transfusionsmedizin und Zelltherapie, respectively). Peripheral blood mononuclear cells (PBMCs) were separated with Lymphocyte Separation Medium (Corning) via density gradient centrifugation. Isolated PBMCs were cryopreserved in FCS containing 10% DMSO. T cells were purified from thawed PBMCs by negative selection using magnetic-activated cell sorting (MACS) with a Pan T Cell Isolation Kit (Miltenyi Biotec), following the manufacturer’s instructions. Isolated T cells were stimulated with CD3/CD28 human T cell Activator Dynabeads (Gibco) in a 1:1 ratio, and plated at 1 × 106 cells per mL in RPMI medium supplemented with FCS and penicillin/streptomycin, and 5 ng/mL of interleukin-7 (IL7) and interleukin-15 (IL15) cytokines (Miltenyi Biotec). Specific stimulation continued for 72 hours before proceeding to T-cell genetic modification. Cells were in all cases maintained in sterile conditions and incubated at 37 °C with 5% CO2.
Genetic modification of T cells
After 72 hours in culture, the Dynabeads were magnetically removed from the activated T cells. Subsequent T cell transduction was performed utilizing recombinant human fibronectin fragment (RetroNectin®, Takara Bio), which aids in the co-localization of target cells and viral particles when subjected to spinoculation. Briefly, non-tissue culture-treated multi-well plates were coated with 15 µg/mL RetroNectin® diluted in PBS for 2 hours at RT. The coating solution was then removed, and the following transduction components were added: (1) CAR-coding retroviral supernatant, (2) T cells at a concentration of at 1 M T cells/mL supplemented with 5 ng/mL of IL7 and IL15 cytokines, and (3) RPMI medium to reach the same final volume across all conditions. Spinoculation took place for 1 hour at 130 g and 37 °C. Upon transduction, the cytokine-supplemented medium was replenished every second day.
CAR expression, proliferation and viability of unstimulated CAR-T cells
CAR-T cells are defined as unstimulated when they have not encountered their specific antigen, and are maintained in culture in the presence of IL7 and IL15 cytokines. Expression of the CAR construct on the surface of T cells was determined via flow cytometry starting from day four after transduction. T cells were stained with both AF647® goat anti-mouse IgG F(ab’)2 fragment specific (AffiniPure/Jackson Immuno) and PE mouse anti-human CD271 (LNGFR, BD Biosciences). Cell acquisition was performed on a Cytek® Aurora (Cytek Biosciences) or a LSRFortessa (BD Biosciences) flow cytometer, and subsequent data analysis was carried out with FlowJo v10. For proliferation and viability assays, T cells were counted using an automated cell counter (Countess™, Invitrogen) at multiple time points after transduction, and viability percentages were automatically calculated based on trypan blue exclusion.
Bioluminescence-based cytotoxicity assays
To generate target cells, isogenic cancer cell lines were stably transduced to express firefly luciferase (FFLuc) linked to GFP protein. The GFP+ population was sorted using a BD FACSAria™ Fusion cell sorter (BD Biosciences) to have a pure population of Luc-expressing cells. For the cytotoxic assays, 2 × 104 adherent target cells per well were seeded in black-walled transparent-bottom 96-well plates and incubated at 37 °C and 5% CO2 during 24 hours to allow for attachment. After that, medium was removed, and the co-culture with CAR-T cells was established in triplicate at the indicated range of effector-to-target cell ratios (E:T ratio), in a final volume of 100 µL/well. In every case, the required amount of T cells was calculated based on their percentage of CAR-positive T cells, adjusting the total number of effector cells across treatments via compensation with UT T cells. Target cells alone and 0.2% Triton X-100 were utilized for the minimal and maximal lysis controls (RLU, relative light units), respectively. In the case of target suspension cells, no pre-seeding was required. Following the co-culture of cells during 4 or 18 hours (short- and long-term killing assays, respectively), 100 µL of D-luciferin (ZellBio, GoldBio) diluted 1:10 in PBS was added per well. Bioluminescence was measured using a microplate reader (Infinite® 200 PRO, Tecan), and cell lysis was determined as (1 − (RLUsample)/(RLUmax)) × 100.
Phenotypic characterization
For phenotypic analysis, flow cytometry was performed after staining MPZL1 CAR-T cells with the following mouse anti-human fluorochrome-conjugated antibodies: BUV395 CD4, BV650 CD45RA, and PE CD271 (LNGFR) (BD Biosciences); PE/Cyanine7 CD8a, and PerCP-eFluor 710-LAG3 (Invitrogen); and BV510 CD25, BV711 CD69, APC/Cyanine7 PD-1, and BV421 CD62L (BioLegend), along with 7-AAD cell viability solution (BD Biosciences). Besides, compensation controls using UltraComp eBeadsTM (Invitrogen) and fluorescence minus one (FMO) controls were included. Cell acquisition was done on a Cytek® Aurora flow cytometer (Cytek Biosciences), and subsequent data analysis was carried out with FlowJo v10.
Antigen-dependent proliferation and intracellular cytokine secretion assay
Antigen stimulation assays consisted in the co-culture of MPZL1 CAR-T cells with either MPZL1high JIMT-1 breast cancer cells or the respective MPZL1 knockout cells. For the antigen-dependent proliferation assay, JIMT-1 target cells were irradiated with a dose of 30 grays during 4 minutes to inhibit their proliferative capacity prior to the co-culture. Next, 3 × 105 irradiated cells per well were seeded in 24-well plates, and incubated during 24 hours to allow for attachment. DMEM was removed after one day, and the co-culture was established in triplicate wells by adding 1 × 106 MPZL1 CAR + T cells without cytokines in 500 µL of RPMI per well, with fresh RPMI added every other day. T-cell counts were performed every six days with a cell counter (Countess™, Invitrogen). Subsequently, the co-culture was reestablished by adding 1 × 106 prestimulated CAR-T cells (after a 6-day stimulation period) to freshly irradiated target cells. Restimulation was conducted over three consecutive 6-day periods, with the cumulative number of CAR + T cells calculated as the product of the current CAR-T cell count and the accumulated expansion factor, which incorporates the growth rates of previous stimulations. For the intracellular cytokine secretion assay, a 16-hour co-culture of 5×105 MPZL1 CAR-T cells and 5×105 respective JIMT-1 target cells, seeded one day in advance, was established in 24-well plates. Treatment with PMA/Ionomycin was utilized as a positive control to induce cytokine secretion. During the last 4 hours, a cocktail of Brefeldin A and Monensin (protein transport inhibitor cocktail, Invitrogen) was added to the co-cultures to retain the cytokines within the cells. Next, T cells were washed, stained for cell surface markers (phenotypic analysis), fixed and permeabilized with a fixation and permeabilization buffer set (Invitrogen), according to the manufacturer’s instructions. Intracellular cytokine staining was performed with the following antibodies: APC Mouse Anti-Human/Mouse GZMB and PerCP Rat Anti-Human IL-2 (BioLegend), and BUV737 Mouse Anti-Human IFNγ and BV650 Mouse Anti-Human TNFα (BD Biosciences), along with ViaDye™ Red Fixable Viability Dye (Cytek Biosciences). Both compensation and FMO controls were included. Cell acquisition was done on a Cytek® Aurora flow cytometer (Cytek Biosciences), and subsequent data analysis was carried out with FlowJo v10.
Human cell line-derived mouse xenograft model
Tumors of human origin were established in immunodeficient 7- to 8-week-old NSG mice (Janvier). To this end, 5 × 106 genetically manipulated cells in 100 μL of PBS were subcutaneously injected into each flank of the mouse under isoflurane anesthesia. The xenograft tumors were regularly measured with a caliper, and tumor volume was calculated as (length×(width)2)/2. When the average tumor volume reached a specific size (120 mm3 for breast and 360 mm3 for HCC xenografts), a single dose of 1 × 107 MPZL1 CAR-T cells was intravenously administered to all the animals in the experiment on the same day (time 0). MPZL1 CAR-T cells used for animal treatments were always administered directly after primary ex vivo expansion. Tumor size was monitored over time, and the mice were euthanized by cervical dislocation when any of their tumors reached a maximum diameter of 1.5 cm or, alternatively, if ulcerations appeared. The tumors were resected, photographed, weighed, and finally fixed in 4% paraformaldehyde (PFA) for further processing in IHC applications.
HTVI-induced autochthonous HCC mouse model
Tumors were generated directly in the livers of 7–8-week-old NSG mice by hydrodynamic tail vein injection (HTVI), where 2 mL of NaCl solution (~10% of the mouse body weight) containing naked plasmid DNA was rapidly injected (within 5–7 seconds) into the tail vein, enabling efficient transfection of hepatocytes in vivo78. Tumor formation was monitored following overexpression of c-MYC, alongside human MPZL1, or NICD or mutant CTNNB1 employing the Sleeping Beauty DNA transposon system79 (Supplementary Fig. 2). Tumor formation was induced by overexpression of c-MYC, coupled with either human MPZL1 cDNA or GFP, employing the Sleeping Beauty DNA transposon system79, and CRISPR/Cas9-mediated KO of p53, with the respective plasmids generated as previously described70. (Fig. 5; Supplementary Fig. 7). The groups were respectively named MycOE;p53−/−;MPZL1 and MycOE;p53−/−;GFP. For the intervention experiment, a single dose of 1×107 MPZL1 CAR-T cells was intravenously administered to all the animals 15 days after HTVI, and tumor formation was evaluated by regular palpation of the mice’s bellies. MPZL1 CAR-T cells used for animal treatments were always administered directly after primary ex vivo expansion. When tumors were detected, the mice were euthanized by cervical dislocation. The livers were resected, and bright-field and GFP images were acquired using a stereomicroscope (MZ10F, Leica), and fixed in 4% PFA to be processed for IHC studies. In the short-term experiment, a single dose of 1×107 MPZL1 CAR-T cells was intravenously administered one month after HTVI. One week after CAR-T treatment, all animals were sacrificed and the livers underwent the same processing.
Preparation of naïve T cells, CEA and CA125 CAR-T cells for explant model
For preparation of autologous naive UT T cells, an approximately 0.5 cm² piece of macroscopically detected adjacent liver of liver metastasis explants was placed in a Petri dish and minced with a scalpel. Sheared tissue was gently added on a cell strainer (40 μm mesh) and flushed into a 50 ml falcon tube using RPMI (Sigma-Aldrich). Flow-through was flushed a second time through a new cell strainer, and isolated cells were stained with 5 µM CellTracker™ Green CMFDA (Thermo Fisher Scientific) for 1 hour in cell culture flasks. Non-adherent CMFDA-labeled T cells (CLT) were isolated by negative bead-based isolation using the Dynabeads Untouched Human T Cells Kit (Thermo Fisher Scientific). Autologous naïve UT-CLT were directly re-suspended in explant culture medium and added to the corresponding patient-matched explants without pre-activation.
Naïve allogeneic UT T cells were prepared from peripheral blood of a healthy donor by density gradient centrifugation using Ficoll Paque Plus (Sigma-Aldrich) following 1.5 hours separation of non-adherent cells in cell culture flasks and negative bead-based T cell isolation. T cells were cultured for 48 hours in X-vivo 15 medium (Biozym) with anti-human CD3 antibody (1:10,000, clone OKT3, BioLegend) and addition of 300 Units IL-2 (PeproTech). T cells were stained with 5 µM CMFDA for 1 hour and cryopreserved in FBS (Biochrom) with 10% DMSO. Frozen allogeneic naive UT-CLT were thawed, directly re-suspended in explant culture medium, and added to the explant cultures without re-activation.
CEA and CA125 CAR-T cells were manufactured from peripheral blood of appropriate patients prior to surgery, as documented below, activated for 48 hours by TransAct™ in TexMACS™ medium containing IL-7 and IL-15 (all from Miltenyi Biotec), stained with CMFDA, resuspended in explant culture medium, and added to patient-matched explants. Patient-matched UT T cells were generated similarly from the same peripheral blood samples but without CAR transduction.
Explant model and T-cell tracing
Fresh resected patient tissues were cultured as follows: explants were directly transferred from the operating room to the laboratory in 0.9% sodium saline solution and on ice. Each explant was cut into small pieces containing equal proportions of macroscopically detected tumors. One piece of explant was directly cryopreserved in OCT embedding compound (VWR) and stored as a control. Explant pieces were placed into 96-well plates containing MEM culture medium supplemented with 1% L-GlutaMAX (Thermo Fisher Scientific) and cultured under sterile conditions at 37 °C and 5% carbon dioxide. For T cell tracing, the medium of the explant cultures was removed and CLT were gently added with fresh medium. As a negative control for each patient, one explant piece received only fresh culture media without cells (untreated control). After approximately 24 hours, explants were harvested and cryopreserved in OCT embedding compound80,81.
MPZL1 and CD19 CAR-CLT were added to the explants directly after CMFDA staining. For treatment of the same patients, CAR-CLT were compensated with corresponding UT-CLT to align ratios of CAR expression. Seeded cell numbers varied between 1 × 105 and 1 × 106 cells (for CAR-CLT and UT-CLT) and between 1 × 10³ and 1 × 107 cells (for autologous naive UT-CLT) depending on individual T cell isolation yields, number of living cells, and number of explants treated. For CEA CAR-CLT, the corresponding colorectal cancer liver metastasis tissue was preserved in cryopreservative media (Lonza), thawed, and rinsed for 24 hours in MEM before culture. In total 27 patients with 6 different tumor entities (1xCRC: Colorectal Cancer, 21xHLM: Colorectal Cancer Liver Metastases, 1xPaCa: Pancreatic Ductal Adenocarcinoma, 2xOv: Ovarian Cancer, 1xGaCa: Gastric Cancer and 1xRCC: Renal Cancer) were treated including 6 normal tissues (3xLiver, 1xColon, 1xSpleen, 1xStomach) with 5 corresponding tumors (2xHLM, 1xCRC, 1xGaCa, 1xPaCa) treated with MPZL1 CAR-CLT.
IHC, immunofluorescence and image analysis
For IHC and IF on frozen tissues, 5 µm cryo sections were prepared and fixed either for 5 min in Methanol containing 30% acetone (Anti-CEA and -CA125) or for 20 min in 4% PFA, following six wash steps in PBS for 10 min (Anti-GranB). All sections were incubated for 5 min in Tris-buffered saline with 0.1% Triton-X (TTX) prior to staining. 10% normal goat serum (Vector Laboratories) was used for blocking nonspecific binding molecules. Brightfield immunostaining (DAB) with monoclonal antibodies recognizing CEA (CD66e, rabbit, 1:200, #11077-R327, Sino Biological) and CA125 (MUC16, mouse, 1:200, #NCL-L-CA125, Leica) was performed with the BondTM Polymer Refine Detection Kit (Leica) in the BOND-MAX immunostainer (Leica). Brightfield imaging was performed using the fully automatic microscopic image scanning system Hamamatsu NanoZoomer Digital Pathology (NDP) with the NDP-Viewer Software (Hamamatsu). For immunofluorescence staining, Alexa Fluor 647-conjugated monoclonal antibody against granzyme B (D6E9W, rabbit, 1:100, #71535, Cell Signaling) was applied for 1 hour following 3 wash steps with TBS and mounting with Fluoromount-G with DAPI (Thermo Fisher Scientific). For samples treated with naïve UT-CLT, CEA- and CA125 CAR-CLT, single DAPI staining was performed. Fluorescence signals were detected with the NDP system using FITC, Cy5, and DAPI filters. Image analysis was performed with ImageJ/Fiji74 and HALO software (Indica Labs). To reduce bias from CLT infiltration, only regions 200 µm distance from the tissue border were analyzed.
Multiplex cytokine quantification
For cytokine analysis, the same explants as used for GranB and DAPI staining were utilized. Samples were collected by cutting explants into several 10–15 μm thick slices using a cryostat microtome, and proteins were isolated using the Bio-Plex™ Cell-Lysis-Kit (Bio-Rad Laboratories). The protein concentration of the supernatant was determined using a bicinchoninic acid (BCA) assay (Thermo Fisher Scientific), and quantification of 48 cytokines was performed in a Luminex® Reader (BioPlex System 100, Luminex® Corporation) using the Bio-Plex Pro™ Human Cytokine 27-plex and 21-plex assay kits (#M500KCAF0Y, #MF0005KMII, Bio-Rad Laboratories)80,82.
Generation of CEA and CA125 (MUC-16) CAR-T cells
The scFv binders 4H11 with specificity to MUC-16 and SCA431 with specificity to CEA have been described previously83,84. Standard cloning techniques were used to add the scFv into the respective 2nd generation CAR backbone to create the expression cassettes pRRLSIN-4H11scFv-hIgG1-CD28-4-1BB-CDzeta and pRRLSIN-SCA431scFv-hIgG1-CD28-CD3zeta-OX40, respectively.
A second-generation packaging system was used to generate lentiviral particles. Packaging plasmids pMD2.G and pCMVR8.74 were obtained from Addgene (plasmid # 12259 and # 22036). HEK293T cells were seeded onto 15 cm plates 2 days before transfection (6 × 106 cells/plate, five plates comprise one stack). Transfection of cells was done using 7.5 mM PEI in 150 mM NaCl and with equimolar amounts of plasmids (per stack: 112.5 µg pRRLSIN–39.5 µg pMD2.G–73 µg pCMVR8.74). One day after transfection, the medium was replaced with 14 ml of RPMI1640 (w/o phenol red, w/o FCS) per plate. Two days after transfection, culture supernatant (70 ml per stack) was harvested, filtered (45 µm PVDF filter membranes), and concentrated using sterilized Centricon® Plus-70 Ultracel® PL-100 devices (Merck). Lentiviral particles from one production were pooled and stored at −80 °C. Determination of infectious titer was calculated by FACS measurement of CAR expression85.
Primary human CD3-positive T cells were derived from healthy donor PBMCs by using the human Pan T cell Isolation Kit (Miltenyi Biotec) according to the manufacturer´s instructions. T cells were activated for 48 h by TransAct™ in TexMACS™ medium at a density of 106 cells/ml containing IL-7 (0.1 mg/ml) and IL-15 (0.1 mg/ml) (all from Miltenyi Biotec). Transduction of primary CD3+ cells was done by incubation with concentrated lentiviral supernatant on day 2 after activation with a MOI of 5, in TexMACS™ Medium containing IL-7 and IL-15. Determination of CAR expression was done 48 hours after transduction by FACS using the APC-conjugated anti-CD3 antibody UCHT1 (BD Biosciences) and a PE-conjugated polyclonal anti-Fc F(ab’)2 fragment (Jackson ImmunoResearch), respectively.
Statistics
If not indicated otherwise, statistical analyses were performed using GraphPad Prism 10 (Version 10.0.0). Respective statistical tests and exact p values are provided in the text and figures.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
