Animals
WT female C57BL/6 mice (20–25 g body weight, 6–8 weeks) were purchased from Jackson Laboratory (No: 002019). C57BL/6 Per2-mutant (PER2 functional deficiency, Per2m/m) homozygous mice were generated and provided by the Baylor College of Medicine. This mouse model was created using homologous recombination gene targeting in embryonic stem cells, resulting in the deletion of a 2.1-kb genomic fragment that encodes the critical region of the PAS domain (residues 348–434, including half of the PAS-B subdomain and the entire PAC subdomain) [28, 29].
Cell lines
C57BL/6 mouse triple-negative BC cells E0771 were provided by Professor Peter E. Fecci, Duke University. E0771 were maintained in RPMI-1640 medium supplemented with 10% FBS and 1% P/S (100 U/mL penicillin, 100 µg/mL streptomycin). Human BC cell lines, MDA-MB-231, MCF7, SKBR3, as well as THP1, and HEK-293T, were purchased from ATCC. MDA-MB-231, MCF7, SKBR3, and HEK-293T were maintained in DMEM medium supplemented with 10% FBS and 1% P/S. Human monocyte THP1 was maintained in RPMI-1640 medium supplemented with 10% FBS, 1% P/S, 10 mM sodium pyruvate, 15 mM HEPES, 4.5 g/L glucose, and 0.05 mM β-mercaptoethanol.
Plasmids
V5-DEST-vhPER2 provided by Dr. MinGyu Lee at the University of Texas MD Anderson Cancer Center [40] was used to construct a stably PER2 overexpressing human BC cell line. pLKO.1-shPER2 purchased from Millipore Sigma (TRCN0000330732) was used to construct a stable PER2 down-regulated human BC cell line; pLKO1-puro (TCR1.5) as a control. pGL3/hCD47promoter-1554 was constructed by an established method [41]; the 1554 bp base sequence of the hCD47 promoter sequence was inserted into the vector pGL3 by HindIII/KpnI restriction endonuclease. pGL2/Her2 promoter-1030 was base constructed by an established method; the 1030 bp base sequence of the hHER2 promoter sequence was inserted into the vector pGL2 by HindIII /KpnI restriction endonuclease. PLVX-Flag-CLOCK was constructed by an established method [41]; the CLOCK cDNA (NM_001267843) was purchased from Youbio Biotechnology and inserted into the PLVX-Flag vector by Xho1/BamH1. pLenti-GFP vector (Addgene plasmid #17448) was used to generate a stably GFP-expressing BC cell line. An shRNA plasmid targeting mPer2 (TL501620) was obtained from OriGene Technologies and used to generate a stable mPer2-knockdown E0771 cell line. The pGFP-C-shLenti vector (TR30023) served as the control.
Mouse spontaneous breast tumorigenesis
All experimental mice (WT n = 20, Per2m/m n = 20) were gavaged weekly for six consecutive weeks with 1 mg/100 µL DMBA (Sigma-Aldrich) dissolved in olive oil. Starting from the third week of DMBA administration, 2 mg/50 µL MPA (Selleck) was subcutaneously injected every two weeks in all experimental mice. MPA was dissolved in PEG and methanol for three treatments. The administration time in all experiments was conducted between ZT0-ZT2, and mice were monitored for body weight and tumor formation twice a week and terminated when the tumor volume of experimental mice reached 1400 mm3; tissue samples of tumors and spleens were collected for further analysis.
Per2
m/m subcutaneous syngeneic tumor model
Spontaneous tumors induced in Per2m/m mice were extracted, and the tumor tissues were cut into 2–3 mm pieces before subcutaneous implantation into the syngeneic host mice (WT n = 10, Per2m/m n = 10). After tumor implantation, tumor growth and mouse body weight were measured every 3 days. Tumor volume was calculated using the formula V = a × b² / 2(a, tumor length; b, tumor width). The experiment was terminated when the largest tumor volume in each treatment group reached 1400 mm3. Mice were euthanized, and tumors and spleens were collected for further analysis.
Per2
wt (E0771) syngeneic breast tumor model
WT mice were injected with 1 × 106/50 µL E0771 cells in PBS into the third mammary fat pad. When the tumor volume of experimental mice reached 1000 mm3, the tumor was collected and cut into 2–3 mm pieces. After anesthetizing the experimental mice (WT, n = 8, Per2m/m, n = 8), the tumor mass was implanted into the mammary fat pad and then glued to the wound. The mice’s tumor volume and body weight were measured every 3 days after the injection. The experiment was terminated when the largest tumor volume of mice in each treatment group reached 1400 mm3. Mice were euthanized, and the tissue of tumors and spleens was collected for further analysis.
Hematoxylin and eosin (HE) staining
To assess intratumoral vascularization, HE-stained sections from all tumors in each experimental group were analyzed. For each tumor, five non-overlapping, representative fields of view (at 200× magnification, with a fixed field area) were systematically captured. Vascular density was quantified using ImageJ software (National Institutes of Health). Briefly, for each field, the image was calibrated, and all complete vascular lumens were manually selected based on standard morphological criteria (a clear endothelial cell lining and a visible lumen). For each sample, the three fields with the highest vascular density were selected. Within each field, the total cross-sectional area of the selected vessels was measured. The vascular density for that field was then calculated as: (Total Vascular Area/Total Field Area) × 100%. The final vascular density value for each individual tumor was reported as the mean percentage derived from its five analyzed fields.
Immunohistochemistry (IHC)
FFPE tissue sections (4 µm) were baked, deparaffinized, and subjected to antigen retrieval in citrate buffer (pH 6.1) using microwave heating. After blocking, slides were incubated with a primary antibody overnight at 4 °C, followed by detection using the Vectastain ABC kit with a secondary antibody and a peroxidase substrate. Images were acquired on a Zeiss Axioscan Z1 and quantified using the ImmunoRatio plugin in ImageJ-Fiji. Anti-mFOXP3 (#14-5773-82, 1:100), anti-mCD8 (# PA5-81344, 1:1000), anti-mCD80 (#66406-1-Ig, 1:800), and anti-mCD206 (#18704-1-AP, 1:400) antibodies for IHC and IF staining were purchased from Invitrogen. Anti-hPER2 antibody (#DF12304) was purchased from Affinity.
Immunohistochemical scoring was performed according to previously published methods [42]. Briefly, experienced pathologists independently selected 3–6 representative regions of interest from each specimen for high-magnification imaging (200×). Protein expression was assessed using a four-tier staining intensity scale ranging from 0 to 3+, followed by H-score calculation based on both staining intensity and the proportion of positively stained cells. The scoring system included four categories (0/1+, 1+/2+, 2+/3+, and 3+), and the percentage of positive cells within each category was recorded. Final H-scores were calculated as the weighted sum of the percentages at each staining intensity, generating scores ranging from 0 to 300.
RNA sequencing
TRIzol (Takara) was used to extract total RNA from DMBA/MPA-induced spontaneous tumors in WT and Per2m/m mice. The RNA extracted from WT and Per2m/m tumors was pooled and analyzed by RNA-seq. Enrichment analysis was performed using the phyper function in R to calculate P values, followed by FDR correction to obtain Q values; Q values ≤ 0.05 were considered significant enrichment. The volcano plot was generated from differential gene analysis, and KEGG pathway enrichment analysis was performed on up- and down-regulated differential genes. Gene set enrichment analysis (GSEA) was performed using the GSEA official package to identify a predefined gene set and assess whether there are statistically significant or consistent differences between two phenotypes. To evaluate the directional regulation of enriched terms, enrichment analysis was conducted by incorporating logFC values. For each term, a z-score was computed based on the logFC of its associated molecules, where a positive or negative z-score indicates potential positive or negative regulation, respectively. All statistical analyses and visualizations were conducted in R (version 4.2.1). The results were then visualized using the ggplot2 package, and a chord diagram was generated to present the integrated GO/KEGG enrichment analysis results combined with fold-change information.
Flow cytometry analysis
Single-cell suspensions were prepared from the tissue by application of collagenase IV after lysis of red blood cells and rinses with 0.5% BSA/PBS. Cells were then concentrated to 1 × 106 per sample in 0.5% BSA/PBS and incubated with specific antibodies for 30 min at 37 °C in the dark. Antibody titration was optimized before experimentation, with a 1:50 dilution applied. Positive and negative bead controls (1:1) were applied for channel compensation, and each sample included an FMO control. After incubation, cells were analyzed on a BD FACS Vantage, and data were processed using Flow Jo 10.0 software. The antibodies for flow cytometry, FITC-CD45 (#103122), Percp Cy5.5-CD3 (#100327), APC-CD8 (#100711), PE-CD4 (#100407), APC-Cy7-CD11b (#101225), FITC-CD80 (#104715), APC-CD206 (#141707), were purchased from Biolegend.
Immunoblotting
Protein lysates from cells or tumor tissues were extracted using RIPA buffer supplemented with protease inhibitors (Thermo Fisher). Protein concentration was determined by BCA assay (Pierce), and 20 µg of denatured protein was separated by SDS-PAGE. Proteins were transferred to PVDF membranes using a semi-dry system, blocked with 5% non-fat milk, and probed with primary and HRP-conjugated secondary antibodies. Signal was detected by ECL (#RPN2106) and quantified using ImageJ. Anti-HER2 for WB was from Pierce (#PA5-14632), anti-CD47 for WB was from Santa Cruz (#sc-12730), anti-AKT and anti-p-AKT (ser473) for WB were from Cell signaling (#4972, #4051S), anti-mPER2 for WB was from Genetex (#GTX134478). The β-actin antibody for WB was from Sigma (#A5441).
Real-time PCR
TRIzol was used to extract total RNA according to the manufacturer’s instructions (Takara). For cDNA synthesis, 1 µg of extracted RNA was processed with the SuperScript III cDNA Kit. RT-PCR was performed by SYBR Green PCR master mix kit according to the manufacturer’s instructions on the Real-Time PCR machine (Applied Biosystems/Thermo Fisher Scientific). The corresponding qPCR primers are listed below(5’–3’): mIFN-γ forward, CTTGGCTTTGCAGCTC TTCC; mIFN-γ reverse, GCTCATTGAATGCTTGGCGC; mTNF-α forward, GCCTATGTCTCAGCCTCTTC; mTNF-α reverse, GGAGGTTGACTTTCTCCTGG; mIL6 forward, CGGCCTTCCCT ACTTCACAA; mIL6 reverse, GGATGGTCTTGGTCCTTAGC; mTGF-β forward, TGCGCTTGCAGAGATTAAAA; mTGF-β reverse, CGTCAAAAGACAGCCACTCA; mARG1 forward, TGGC TTGCGAGACGTAGAC; mARG1 reverse, CTCCTCTGCTGTCTTCCCA; mIL10 forward, ATACTGCTAACCGACTCCT; mIL10 reverse, ATGGCCTTGTAGACACCT; mβ-actin forward, TCCTCCTGAGCGCAAGTACTCT; mβ-actin reverse, GCTCAGTAACAGTCCGCCTAGAA; hHER2 forward, GGAGAACCCCGAGTACTTGAC; hHER2 reverse, GTTCTCTGCCGTAGGTGTCC; hCD47 forward, AGAAGGTGAAACGATCATCGAGC; hCD47 reverse, CTCATCCATA CCACCGGATCT; hPER2 forward, AGGGACTGTGGCAGCACC; hPER2 reverse, TGCAGCAGGTTGAGCTGC; hβ-actin forward, CATGTACGTTGCTATCCAGGC; hβ-actin reverse, CTCCTT AATGTCACGCACGAT.
Establishment of PER2 overexpressing and knockdown cells
For transfection of HEK-293T cells with pLenti6.3/V5-DEST-vhPER2 or pLKO.1-shPER2, using pLenti-GFP and pLKO.1-puro as control vectors, lentiviruses were generated in 293T cells according to the protocol from Addgene. The resulting PER2-overexpressing (PER2-OE) or shPER2 lentiviruses were then used to infect a human BC cell line, with a 1:1 ratio of cell culture medium (without penicillin/streptomycin) supplemented with 8 µg/mL Polybrene. Stably transfected cells were selected using a puromycin-added medium. Use RT-PCR or immunoblotting to verify gene editing status. In parallel, stable mPer2-knockdown E0771 cells were generated using the same lentiviral procedure with a pLenti-sh-mPer2 plasmid, with pLenti-GFP as the control.
Clonogenic survival assay
For the clonogenic survival assay, cells (600 for 231, 500 for MCF7, and 800 for SKBR3) were seeded per well and incubated for 7–14 days. After culture termination, the medium was discarded, and cells were washed twice with PBS. Coomassie Brilliant Blue solution (2 mL) was then added for 30 min, followed by two rinses with PBS and additional rinsing with distilled water until clear. Colony formation was captured and counted using ImageJ software.
Transwell invasion assay
Matrigel (#356231. BD Biosciences) was diluted with serum-free DMEM at a volume ratio of 1:1000 µL and added to the upper chamber of a 24-well Transwell and incubated for 2–4 h at 37 °C to allow gelling. 200 µL of cell suspension (2.5 × 104 cells) in 1% PBS was added to the upper chamber, and 700 µL of cell culture medium with 10% FBS was added to the lower chamber. Cells were incubated for 48 h, stained using the Diff-Quick Stain kit (#K7128, IMEB INC), and analyzed under a microscope.
Cell proliferation assay
Cells were seeded in a 96-well plate (4000 cells/ 200 µL/well) with six replicates per condition, incubating for 4 days with readings at 24, 48, 72, and 96 h. After adding 20 µL of MTS reagent to each well, cells were incubated for 3 h at 37 °C. Absorbance at 490 nm was measured with a microplate reader. Cell proliferation was determined by subtracting medium absorbance from cell absorbance.
Immunofluorescence
FFPE sections were deparaffinized, rehydrated, and subjected to antigen retrieval. Cultured cells on coverslips were fixed with 4% PFA and permeabilized with 0.1% Triton X-100. All samples were blocked with 10% normal horse serum and incubated with double primary antibodies overnight at 4 °C. After washing, samples were incubated with fluorescent secondary antibodies (1:50) for 2 h at room temperature, treated with Sudan black, and mounted with DAPI. Imaging was performed at 200× magnification on a Zeiss Axioscan Z1, and images were analyzed using Zen 3.4. Anti-rabbit-AF488 secondary antibodies for IF were from Molecular Probes (#A11008) at a 1:200 dilution. anti-rat-AF647 (#A21247) and anti-mouse-AF488 (#A11009) secondary antibody for IF were from Invitrogen with 1:200 dilutions. Anti-rabbit Rhodamine Red secondary antibody for IF was from Immuno Research (#115035003).
Macrophage induction and polarization
Mouse bone marrow-derived monocytes were cultured in DMEM/F12 medium with 10% FBS, 1% P/S, 5 mM L-glutamine, and 10 µM M-CSF for 5–7 days to promote cell differentiation. Cells were then seeded at 1 × 106 cells per well in a 6-well plate and incubated overnight. For polarization, cells were treated with LPS (50 ng/mL) and IFN-γ (20 ng/mL) for 48 h to generate M1 macrophages, or with IL-13 (20 ng/mL) and IL-4 (20 ng/mL) for 48 h to polarize macrophages for phagocytotic analysis.
T cell cytotoxicity
Cytotoxicity of spleen T-lymphocytes isolated from Per2m/m and WT mice against mouse BC E0771 target cells was assessed with an LDH-cytotoxicity kit. Following co-culture for 24 h at varying effector-to-target ratios (1:10 to 1:100), LDH activity in the supernatant was quantified by measuring absorbance at 490 nm and 680 nm. The percentage of cytotoxicity was calculated as specified by the manufacturer.
Phagocytosis assay
Macrophages, derived from bone marrow or THP-1 monocytes treated with 40 nM PMA for 48 h, were co-cultured with GFP-expressing an array of BC cells (MCF-7, SKBR3, MDA-MB-231) stably generated via lentiviral transduction using a pLenti-GFP vector, followed by puromycin selection to ensure uniform GFP expression. After 4 h of co-culture under standard conditions, cells were harvested, stained with APC-Cy7-CD11b and analyzed by flow cytometry. Phagocytic activity was measured as the proportion of CD11b+GFP+ double-positive cells, representing macrophages that had engulfed tumor-derived GFP signal.
Luc-reporter assay
Cells were seeded at 7000 cells per well in a 96-well plate and incubated overnight. Transfection was performed using TurboFect with pGL3/hCD47 promoter-1554 or pGL2/HER2 promoter-530 luciferase reporters, and Renilla-Pol was co-transfected.III as an internal control. Cells were lysed using Luciferase Lysis Buffer, and luciferase activity was measured with a Turner TD20/20 luminometer (Promega, Madison, WI). Luciferase activity in each cell line was normalized to the Renilla signal ratio for comparative analysis.
Chromatin immunoprecipitation quantitative PCR (ChIP-qPCR)
Chromatin immunoprecipitation (ChIP) was conducted per the manufacturer’s protocol for the Abcam kit (#ab270816). Briefly, MCF-7 cells expressing Flag-CLOCK were fixed with formaldehyde, and the chromatin was fragmented by sonication. Samples were immunoprecipitated overnight at 4 °C with anti- Flag (CST, #14793 T) or control IgG (CST, #2729S) antibody, followed by capture with protein A/G beads. After washing, bound DNA was purified and quantified by qPCR using promoter-specific primers for CD47 and HER2. Data were normalized to input and presented as fold enrichment over IgG using the 2(–ΔΔCt) method (CD47-promoter F: 5’-AACACAGGGTTCAGCC TCCT-3’, CD47-promoter R: 5’-CAGTCGCAGGCTCCAGAC-3’; HER2-promoter F: 5’-TGGGCAGGGCA TTTAATCTCT-3’; HER2-promoter R: 5’-AGGAGGGACTTTGGACTGGT-3’).
Gene mutation and plasmid construction
Mutagenic oligonucleotide primers deClock185 hHER2, deClock329 hCD47 and deClock382 were designed in the QuikChange primer design platform. According to the manufacturer’s instructions, the Quik Change Lightning Site-Directed Mutagenesis Kit was applied to gene mutations, and mutant plasmids were verified by DNA sequencing. The rPER2-ΔPAS-B plasmid was generated by circular PCR mutagenesis of the V5-DEST-vhPER2 template using flanking primers (PER2-PAS-B-mut-F: 5’-AGAGTGCACTCTGGTTCAGG CGGGCAGCCTTTC-3’; PER2-PAS-B-mut-R: 5’-TGAACCAGAGTGCACTCTCTCTGCCAGCA GAAGGCAGC-3’) to delete the PAS-B domain. PCR products were DpnI-digested, self-ligated, and validated by sequencing.
Online database analysis
Kaplan-Meier Plotter (http://kmplot.com/) was used to analyze the relationship between PER2 mRNA expression and BC prognosis. Two groups (PER2 high vs. PER2 low expression) were compared using Kaplan-Meier survival analysis, with hazard ratios and log-rank p-values calculated. Additionally, the TIMER database (https://cistrome.shinyapps.io/timer/) was used to compare PER2 expression between tumor and normal tissues from TCGA. Sangerbox (http://sangerbox.com/home.html) also provided data on differential PER2 expression in BC tissues, with survival analysis of high vs. low expression groups.
Statistical analysis
All experiments were repeated three times independently, and experimental data are expressed as mean ± SE. F test to compare variances. Statistical analyses were performed using the two-tailed Student’s t test for comparisons between two groups or ANOVA for multiple groups. For non-parametric data, the Mann-Whitney test was used. A two-tailed Log-rank test was used to calculate the difference in the Kaplan-Meier survival curve, and Cox regression analysis was employed to develop the risk model. For survival analysis of PER2 expression in tissue microarrays, the Gehan–Breslow–Wilcoxon test was used to construct the risk model. The Gehan–Breslow–Wilcoxon test was used because it provides greater weight to early survival differences, which were prominent in our cohort. p values less than 0.05 were significant and indicated by asterisks as follows: *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.
Ethics approval and consent to participate
All animal experiments were performed in accordance with relevant guidelines and regulations and were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of California, Davis (approval number: IACUC 15315). Human BC tissue microarrays together with matched adjacent non-tumorous tissues (HBreD161Su01+HBreD067Su01) were obtained from Shanghai Outdo Biotech Co., Ltd. (Shanghai, China). Ethical approval for the use of these specimens was granted by the Ethics Committee of Shanghai Outdo Biotech Co., Ltd.
